ID: 977876311

View in Genome Browser
Species Human (GRCh38)
Location 4:102154697-102154719
Sequence TGCCTCATAGTCCATTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977876311_977876314 -6 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data
977876311_977876313 -7 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876313 4:102154713-102154735 TGAGGCAAATTCTCTGTTGAGGG No data
977876311_977876317 25 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876317 4:102154745-102154767 CAAGGCATCAAAAGTAAGAAAGG No data
977876311_977876312 -8 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data
977876311_977876315 7 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876315 4:102154727-102154749 TGTTGAGGGGTACAATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977876311 Original CRISPR TGCCTCATAGTCCATTTTCT AGG (reversed) Intergenic
No off target data available for this crispr