ID: 977876312

View in Genome Browser
Species Human (GRCh38)
Location 4:102154712-102154734
Sequence ATGAGGCAAATTCTCTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977876304_977876312 28 Left 977876304 4:102154661-102154683 CCCCTCTGTAAAATGATACTGAC No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data
977876305_977876312 27 Left 977876305 4:102154662-102154684 CCCTCTGTAAAATGATACTGACA No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data
977876310_977876312 -7 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data
977876311_977876312 -8 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data
977876306_977876312 26 Left 977876306 4:102154663-102154685 CCTCTGTAAAATGATACTGACAT No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977876312 Original CRISPR ATGAGGCAAATTCTCTGTTG AGG Intergenic
No off target data available for this crispr