ID: 977876314

View in Genome Browser
Species Human (GRCh38)
Location 4:102154714-102154736
Sequence GAGGCAAATTCTCTGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977876311_977876314 -6 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data
977876305_977876314 29 Left 977876305 4:102154662-102154684 CCCTCTGTAAAATGATACTGACA No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data
977876306_977876314 28 Left 977876306 4:102154663-102154685 CCTCTGTAAAATGATACTGACAT No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data
977876304_977876314 30 Left 977876304 4:102154661-102154683 CCCCTCTGTAAAATGATACTGAC No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data
977876310_977876314 -5 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977876314 Original CRISPR GAGGCAAATTCTCTGTTGAG GGG Intergenic
No off target data available for this crispr