ID: 977876315

View in Genome Browser
Species Human (GRCh38)
Location 4:102154727-102154749
Sequence TGTTGAGGGGTACAATACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977876310_977876315 8 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876315 4:102154727-102154749 TGTTGAGGGGTACAATACCAAGG No data
977876311_977876315 7 Left 977876311 4:102154697-102154719 CCTAGAAAATGGACTATGAGGCA No data
Right 977876315 4:102154727-102154749 TGTTGAGGGGTACAATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977876315 Original CRISPR TGTTGAGGGGTACAATACCA AGG Intergenic
No off target data available for this crispr