ID: 977880899

View in Genome Browser
Species Human (GRCh38)
Location 4:102204542-102204564
Sequence CCAGAGAAGCAACAGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977880899_977880904 2 Left 977880899 4:102204542-102204564 CCTGACACCTGTTGCTTCTCTGG No data
Right 977880904 4:102204567-102204589 GGCTGCTGTTTGAATCAAGGTGG No data
977880899_977880903 -1 Left 977880899 4:102204542-102204564 CCTGACACCTGTTGCTTCTCTGG No data
Right 977880903 4:102204564-102204586 GCTGGCTGCTGTTTGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977880899 Original CRISPR CCAGAGAAGCAACAGGTGTC AGG (reversed) Intergenic
No off target data available for this crispr