ID: 977883327

View in Genome Browser
Species Human (GRCh38)
Location 4:102231723-102231745
Sequence TGTTCCTCCCTTACTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977883327_977883331 28 Left 977883327 4:102231723-102231745 CCTCCCACAGTAAGGGAGGAACA No data
Right 977883331 4:102231774-102231796 CTTTGATATAAATTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977883327 Original CRISPR TGTTCCTCCCTTACTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr