ID: 977890667

View in Genome Browser
Species Human (GRCh38)
Location 4:102307931-102307953
Sequence CTTGAGCCATAGATGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977890667_977890669 19 Left 977890667 4:102307931-102307953 CCTAGTTTCATCTATGGCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 130
Right 977890669 4:102307973-102307995 TTTGAAAAAAAAGAAAAAACAGG 0: 1
1: 3
2: 130
3: 1558
4: 12196
977890667_977890671 21 Left 977890667 4:102307931-102307953 CCTAGTTTCATCTATGGCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 130
Right 977890671 4:102307975-102307997 TGAAAAAAAAGAAAAAACAGGGG 0: 1
1: 4
2: 129
3: 2115
4: 20788
977890667_977890670 20 Left 977890667 4:102307931-102307953 CCTAGTTTCATCTATGGCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 130
Right 977890670 4:102307974-102307996 TTGAAAAAAAAGAAAAAACAGGG 0: 1
1: 5
2: 166
3: 2363
4: 17200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977890667 Original CRISPR CTTGAGCCATAGATGAAACT AGG (reversed) Intronic
902288471 1:15421708-15421730 CTTGAGCAATAAATAAAGCTGGG + Intronic
902845461 1:19106889-19106911 CTTGAGCCACAGTTGAGCCTGGG + Exonic
903602710 1:24554216-24554238 CTTGAGCCATAGATAACAGAAGG + Intergenic
905374420 1:37509573-37509595 CTTGAGCCATAGACATAGCTTGG - Intronic
907765250 1:57403410-57403432 CTCTAGCCATAGCTGCAACTAGG + Intronic
908671919 1:66557471-66557493 CTTGAGCCTGACATTAAACTCGG + Intronic
910058063 1:83055512-83055534 CTGGAGCCAGGGAGGAAACTTGG + Intergenic
911405848 1:97438285-97438307 CTTTATCCATAGATAAAAATGGG + Intronic
912159835 1:106968271-106968293 CTTGAGCCATAGATGAACGATGG + Intergenic
912258734 1:108087410-108087432 CCTCTGCCATTGATGAAACTGGG - Intergenic
912484659 1:110016216-110016238 CTTGGGCAATAAATGAGACTGGG + Intronic
912992051 1:114497829-114497851 CTCGAGCAATAGATGATCCTTGG - Intronic
914382749 1:147132973-147132995 CCTGAGCTATAGATGCAACTGGG - Intergenic
915641675 1:157232335-157232357 CCTGAGTCAAAGATCAAACTGGG - Intergenic
916864477 1:168840791-168840813 ATTGACCAATAGAGGAAACTTGG + Intergenic
918187427 1:182140818-182140840 CTACAGCCTGAGATGAAACTTGG - Intergenic
918682289 1:187370657-187370679 GTTGAGCCATAAATGACAGTGGG + Intergenic
1063767723 10:9161241-9161263 CTTGAGTCTCAGATGAGACTTGG + Intergenic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1064279918 10:13942195-13942217 ATTCAGCCACAAATGAAACTGGG + Intronic
1064960415 10:20957841-20957863 TTTGTGCCATAGATGAAAACTGG - Intronic
1066473523 10:35722494-35722516 CATGAGACAAAAATGAAACTTGG + Intergenic
1067662831 10:48249396-48249418 CTTGGGCCACAGATGAATTTAGG - Intronic
1069583417 10:69580305-69580327 CTTGAGCCTAAAATAAAACTTGG - Intergenic
1070760915 10:79023922-79023944 CTTTAGCCAGAGAGGAAACAAGG + Intergenic
1070968365 10:80543561-80543583 CTTGAGTGGTAGATGAGACTGGG - Intronic
1072214868 10:93279600-93279622 ATTGAGCTATAGATTAAATTAGG + Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1073760406 10:106622963-106622985 CTTGTGCAATAAATGAAACCAGG - Intronic
1073938795 10:108669246-108669268 CTTGAGCCACAGGAGAAAATAGG - Intergenic
1078721893 11:13892596-13892618 CATGAACAATAGAGGAAACTGGG - Intergenic
1086137010 11:83451954-83451976 AATGTGCCATATATGAAACTGGG - Intergenic
1086624378 11:88928413-88928435 GTCAATCCATAGATGAAACTTGG - Intronic
1088169801 11:106982973-106982995 CTTGAGCCCTATCTGAACCTAGG + Intronic
1091858364 12:3756926-3756948 CTTGGTTCATAGATGAAACAGGG - Intronic
1092280314 12:7093001-7093023 CTTTAGCCATGAATGACACTTGG + Intronic
1092783780 12:12010045-12010067 CTTTGGCCATAGATGGACCTCGG + Intergenic
1096219173 12:49817518-49817540 CTTGAGCAAAAGAACAAACTTGG + Intronic
1101197638 12:102401506-102401528 CTGGAGCCAAAGATGACACAAGG - Intronic
1104829710 12:131741792-131741814 TCTGAGCCACAGATGAATCTGGG - Intronic
1107159615 13:37210944-37210966 CTTGAGCCACAGATCTGACTGGG - Intergenic
1108722646 13:53148065-53148087 CCTGGACCAAAGATGAAACTGGG - Intergenic
1110527559 13:76556491-76556513 CTATAAGCATAGATGAAACTTGG - Intergenic
1110680039 13:78299424-78299446 CTTGATCCAAATATGTAACTGGG + Intergenic
1113310036 13:109122144-109122166 CTGCAGCCTTAGCTGAAACTGGG + Intronic
1113983019 13:114292118-114292140 CTTGAGCCGAAAATGAAAGTTGG - Intronic
1115509935 14:34129322-34129344 CTTGAGCCATATCTTAAAATTGG - Intronic
1116976516 14:51122484-51122506 CCTGAGTCACCGATGAAACTAGG + Intergenic
1202841062 14_GL000009v2_random:121874-121896 CTTGACTCATGGATGAAACCCGG - Intergenic
1202882130 14_KI270722v1_random:70399-70421 CTTGATTCATGGATGAAACCTGG + Intergenic
1123908469 15:24943413-24943435 CATGAGCCATAGGTGCAGCTGGG + Intronic
1126050113 15:44677569-44677591 CTTGAGGGTTAGATGAGACTTGG - Intronic
1126534181 15:49742585-49742607 CTTGGGCCATAAGTGAAAATTGG + Intergenic
1128950980 15:71881461-71881483 CTTGTGTCATAGTTGAAATTGGG - Intronic
1137479490 16:48839949-48839971 CATGAGCAAAAGAAGAAACTGGG + Intergenic
1139408361 16:66737908-66737930 CTTGAGCCAGAGAAGAAAACAGG + Intronic
1144903804 17:18624075-18624097 CATGAGTCATGGATGAGACTTGG + Intergenic
1145374135 17:22332074-22332096 CTTGAACCCGAGATGAAAGTTGG - Intergenic
1149606819 17:57930959-57930981 CTTGTGCCAGAAATGGAACTAGG - Intronic
1152123361 17:78432412-78432434 CATGGGCCATAGATGCCACTGGG - Intronic
1155775466 18:29755373-29755395 TTTGAGACATATATGAAAATCGG - Intergenic
1156892507 18:42205920-42205942 CTTGAGACATACTTGAGACTGGG - Intergenic
1158569156 18:58582112-58582134 CTTGACCCATGGCTGATACTGGG + Intronic
1202631240 1_KI270706v1_random:1900-1922 CTTGATTCATGGATGAAACCCGG + Intergenic
1202657741 1_KI270708v1_random:39497-39519 CTTGATTCATGGATGAAACCTGG + Intergenic
926876398 2:17484760-17484782 CATGAGCCATAGATAGCACTTGG - Intergenic
927150143 2:20190929-20190951 CTTCAGGCACAGATGAGACTTGG - Intergenic
927467066 2:23345277-23345299 CTGGAGAGATAGAGGAAACTTGG - Intergenic
928355462 2:30609596-30609618 CTTGAGATTTAGAAGAAACTGGG - Intronic
929903170 2:46023589-46023611 CTTGACCCATAGCTTGAACTAGG + Intronic
933307912 2:80625166-80625188 CTTGTACAATTGATGAAACTGGG + Intronic
936170587 2:110168795-110168817 CTTGAGCCATTTATGCAAATGGG + Intronic
936828257 2:116607840-116607862 CTAGAGTCATAGATAAATCTAGG - Intergenic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
940071588 2:149694379-149694401 CATGAGCCATAAATTCAACTTGG + Intergenic
940587787 2:155676006-155676028 ATTAAGACATAGAGGAAACTTGG + Intergenic
940856465 2:158732162-158732184 CTTGAAAGATAGATGAAATTTGG - Intergenic
941831446 2:169965116-169965138 CTTGAGCAATGGGTGAAAATGGG - Intronic
944972067 2:205004208-205004230 CTTGTCTCATAGAGGAAACTAGG + Intronic
945063459 2:205928250-205928272 CTTGATGGATAGATGAGACTCGG + Intergenic
945127780 2:206531841-206531863 CTTGTGCCATATAGGTAACTGGG + Intronic
947536181 2:230941640-230941662 CCAGAGCCAGAGATGAGACTGGG - Intronic
948466825 2:238156266-238156288 CTTGAGCCATAGCTGCAGCCAGG + Intergenic
948478741 2:238237688-238237710 CTTGAGCGTTAGGTCAAACTGGG - Intergenic
1169355638 20:4902705-4902727 CTTGAGCCAAAGAGAATACTTGG - Intronic
1174170692 20:48616506-48616528 TGTGAGCCATGGATGGAACTTGG + Intergenic
1176643463 21:9327840-9327862 CTTGATTCATGGATGAAACCTGG + Intergenic
1180369472 22:11971376-11971398 CTTGATTCATGGATGAAACCCGG - Intergenic
1180376761 22:12100734-12100756 CTTGATTCATGGATGAAACCCGG + Intergenic
1180628346 22:17209576-17209598 CTCTATCCATAGATGAAACACGG - Exonic
950256780 3:11512323-11512345 CTTGACCCAGAGGTGGAACTCGG - Intronic
950811062 3:15650492-15650514 CTTCAGCCATTGCTGAATCTAGG + Intergenic
953654901 3:44842608-44842630 CTTGAAACTTAGAAGAAACTGGG + Intronic
957096573 3:75782378-75782400 CTTGATTCATGGATGAAACCTGG - Intronic
963372365 3:144417284-144417306 ACTTAGCGATAGATGAAACTTGG + Intergenic
964473976 3:157082351-157082373 CTGGAGACATGGAAGAAACTGGG + Intergenic
966078108 3:175963704-175963726 CTTGAGCAATAGATGATTCTAGG + Intergenic
1202743419 3_GL000221v1_random:77189-77211 CTTGATTCATGGATGAAACCTGG - Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
976850386 4:89538353-89538375 CATGAGCAATAGAGGAAACCTGG - Intergenic
977890667 4:102307931-102307953 CTTGAGCCATAGATGAAACTAGG - Intronic
978285983 4:107077125-107077147 CTTTAGCCCTAGATAAAACTGGG + Intronic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
982643786 4:157996569-157996591 CTTGACCCAGAGGGGAAACTGGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
991024732 5:62017305-62017327 CATAAGCCATGGATAAAACTGGG - Intergenic
992747670 5:79835322-79835344 CTTGAGGCAGAGATGAAATCTGG + Intergenic
995188056 5:109291398-109291420 CTTGAGCCAGAGAACAAAGTTGG + Intergenic
998140031 5:139694560-139694582 ATTGGCCCCTAGATGAAACTGGG - Intergenic
998894107 5:146779704-146779726 CCTGAGCCATAAATTAAACCCGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000164224 5:158631842-158631864 CTTAAGCCAATGATGAGACTAGG - Intergenic
1004568467 6:16821806-16821828 CTTGCTCCATAGATGACACAGGG + Intergenic
1005260060 6:24049592-24049614 CTTGAGCAATAGATAAGATTAGG + Intergenic
1011939243 6:92822182-92822204 CTTGTTCCATAGATAATACTTGG + Intergenic
1015223307 6:130829123-130829145 ATCCAGCCAGAGATGAAACTTGG - Intronic
1016004179 6:139072324-139072346 CTTGACCTATAGATGACAGTTGG + Intergenic
1028556062 7:92126241-92126263 CTTTATCCATACCTGAAACTAGG + Exonic
1032981722 7:137291893-137291915 CTTGAGAAGTAGATGTAACTTGG + Intronic
1043328732 8:79086602-79086624 CTTGAACCAACGATGTAACTAGG + Intergenic
1046073822 8:109291995-109292017 CTTGAGCCAAAGCTGAATCTAGG + Intronic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1052576626 9:30299613-30299635 CTTGGGCCATCGATGGGACTGGG - Intergenic
1203689968 Un_GL000214v1:33177-33199 CTTGATTCATGGATGAAACCTGG + Intergenic
1203712054 Un_KI270742v1:107153-107175 CTTGATTCATGGATGAAACCTGG - Intergenic
1203539151 Un_KI270743v1:71039-71061 CTTGATTCATGGATGAAACCCGG + Intergenic
1203646307 Un_KI270751v1:70876-70898 CTTGATTCATGGATGAAACCTGG - Intergenic
1187075565 X:15930984-15931006 CTTGATCCATAGCTGGAACAAGG - Intergenic
1188977136 X:36689310-36689332 CTTGAGACTTAGAGGAATCTGGG - Intergenic
1192085448 X:68091791-68091813 CTTGAGGCATAGAGGTAATTTGG - Intronic
1198415159 X:136412547-136412569 CTTGGGCCATATTTTAAACTAGG + Intronic
1199243449 X:145575147-145575169 CTTGAGCCATAGCTAGAGCTGGG - Intergenic
1199534479 X:148886620-148886642 CATGAGTCATACATGATACTTGG - Intronic
1201166285 Y:11212096-11212118 CTTGACTCATGGATGAAACCTGG - Intergenic
1201515154 Y:14812340-14812362 CCAGAGCCCTGGATGAAACTTGG + Intronic