ID: 977899693

View in Genome Browser
Species Human (GRCh38)
Location 4:102405669-102405691
Sequence AGACATAAAACTGAGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977899692_977899693 -4 Left 977899692 4:102405650-102405672 CCAAGATACAAGAGATAACAGAC 0: 1
1: 0
2: 1
3: 10
4: 220
Right 977899693 4:102405669-102405691 AGACATAAAACTGAGTTTTGAGG No data
977899691_977899693 30 Left 977899691 4:102405616-102405638 CCAGAATATTGAATTGGAAGCTG 0: 1
1: 0
2: 0
3: 13
4: 149
Right 977899693 4:102405669-102405691 AGACATAAAACTGAGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977899693 Original CRISPR AGACATAAAACTGAGTTTTG AGG Intronic
No off target data available for this crispr