ID: 977902664

View in Genome Browser
Species Human (GRCh38)
Location 4:102440136-102440158
Sequence GCTTCTTTCTTACCAGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977902664_977902665 18 Left 977902664 4:102440136-102440158 CCTTTATCTGGTAAGAAAGAAGC No data
Right 977902665 4:102440177-102440199 CTTAGTTTGTTTCTGATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977902664 Original CRISPR GCTTCTTTCTTACCAGATAA AGG (reversed) Intergenic
No off target data available for this crispr