ID: 977907603

View in Genome Browser
Species Human (GRCh38)
Location 4:102496608-102496630
Sequence CCTAACAAACACATTCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977907599_977907603 5 Left 977907599 4:102496580-102496602 CCAGTCTGAGATATTTTGTTTTG No data
Right 977907603 4:102496608-102496630 CCTAACAAACACATTCTCTAAGG No data
977907598_977907603 6 Left 977907598 4:102496579-102496601 CCCAGTCTGAGATATTTTGTTTT No data
Right 977907603 4:102496608-102496630 CCTAACAAACACATTCTCTAAGG No data
977907597_977907603 9 Left 977907597 4:102496576-102496598 CCACCCAGTCTGAGATATTTTGT No data
Right 977907603 4:102496608-102496630 CCTAACAAACACATTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977907603 Original CRISPR CCTAACAAACACATTCTCTA AGG Intergenic
No off target data available for this crispr