ID: 977908226

View in Genome Browser
Species Human (GRCh38)
Location 4:102501457-102501479
Sequence CCGCCAGCCGCCGCAGCCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 308}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977908221_977908226 -5 Left 977908221 4:102501439-102501461 CCCTTCCCGTCGGTCGGGCCGCC 0: 1
1: 0
2: 0
3: 4
4: 25
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308
977908222_977908226 -6 Left 977908222 4:102501440-102501462 CCTTCCCGTCGGTCGGGCCGCCA 0: 1
1: 0
2: 0
3: 0
4: 30
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308
977908214_977908226 22 Left 977908214 4:102501412-102501434 CCGGCGACGCGCTGACAGCTTCC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308
977908218_977908226 0 Left 977908218 4:102501434-102501456 CCCTGCCCTTCCCGTCGGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308
977908220_977908226 -1 Left 977908220 4:102501435-102501457 CCTGCCCTTCCCGTCGGTCGGGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308
977908223_977908226 -10 Left 977908223 4:102501444-102501466 CCCGTCGGTCGGGCCGCCAGCCG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308
977908213_977908226 23 Left 977908213 4:102501411-102501433 CCCGGCGACGCGCTGACAGCTTC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308
977908216_977908226 1 Left 977908216 4:102501433-102501455 CCCCTGCCCTTCCCGTCGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977908226 Original CRISPR CCGCCAGCCGCCGCAGCCCT CGG Exonic
900629865 1:3628661-3628683 CCCCCAGCCCCCACATCCCTTGG - Exonic
900633934 1:3652620-3652642 CCTGCAGCCGTCGCAGCCCCGGG - Exonic
900751593 1:4401304-4401326 CCACCAGCAGGAGCAGCCCTGGG - Intergenic
900777552 1:4596048-4596070 CACCCAGCCGTGGCAGCCCTGGG - Intergenic
901629026 1:10639249-10639271 CCGCCCGACGCCGCCGCCCCCGG - Exonic
901630332 1:10644891-10644913 CTGCCCGCAGCCCCAGCCCTCGG + Intronic
901863376 1:12088793-12088815 CCCCCAGCTTCCGCTGCCCTTGG + Intronic
902379607 1:16046484-16046506 CCCACAGCCTCTGCAGCCCTCGG - Intronic
903187180 1:21635285-21635307 TCCCCAGCCTCCGCAGCCCAGGG + Intronic
903777094 1:25800213-25800235 CCGCCGCCAGCCGCAGCCATGGG + Exonic
903907389 1:26696448-26696470 CCCGCCGCCGCCGCCGCCCTCGG + Exonic
904143190 1:28369730-28369752 CAGGCAGCAGCCGGAGCCCTTGG - Intronic
905145235 1:35883084-35883106 CCGCCAGGGGCCGCTGCCTTGGG + Intronic
905639145 1:39576583-39576605 GCGCCCGCCGCCGCAGCGCTTGG - Intronic
906058685 1:42934690-42934712 CCAGCAGCCTCCGCAACCCTGGG + Intronic
906325522 1:44843161-44843183 CCTCCAGCCGCCGCGGCCCACGG - Intergenic
911188295 1:94925656-94925678 CCGCCTACCCCCGCAGCCCCGGG + Intronic
911725308 1:101236458-101236480 CCCACACCCCCCGCAGCCCTAGG - Intergenic
914831957 1:151176720-151176742 CCGCCCACTGCCTCAGCCCTGGG - Exonic
919981294 1:202644098-202644120 CCGCGGGCTGCCGGAGCCCTCGG - Intronic
920293922 1:204944321-204944343 CAGGCAGCCACCGCCGCCCTGGG + Exonic
920597555 1:207288049-207288071 CAGCTAGCTGCCTCAGCCCTTGG - Intergenic
922513148 1:226186476-226186498 CCCCCAGCCGCCGCCTCCCCGGG + Exonic
922724137 1:227914733-227914755 CAGCCAGGCCCCGCTGCCCTTGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1062909789 10:1205172-1205194 GCGCCAGCCGAGGCAGCCCCCGG - Intronic
1063443056 10:6089097-6089119 CCGCCAGCGGCAGGAGGCCTCGG - Intronic
1064028751 10:11869824-11869846 CAGCCACCCGGCGCAGCCCAAGG + Exonic
1064978793 10:21145803-21145825 TCTCCAGCTGCCGGAGCCCTTGG - Intronic
1067015584 10:42754784-42754806 CCCCCAGCCGCCGGCGCTCTCGG + Intergenic
1067850575 10:49751436-49751458 CCCCCAGCCCCTGCAGCCCTGGG + Intronic
1069813443 10:71179011-71179033 CCACCAGCCTCCTCAGCCCTGGG + Intergenic
1069874698 10:71554560-71554582 CCTCCAGCCCCTGCAGCCCTGGG + Intronic
1074102776 10:110366499-110366521 CCACCAGCCTTGGCAGCCCTGGG - Intergenic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074587886 10:114786738-114786760 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1075129542 10:119726226-119726248 CCGCGGGCCGCCGCCTCCCTGGG + Exonic
1075438916 10:122463962-122463984 CAGCCAGCCTCTTCAGCCCTGGG - Intronic
1075827463 10:125371277-125371299 CCGCCATCCTCCCCAGCCCTAGG + Intergenic
1076363872 10:129909749-129909771 CCGTCAGCCGCCAAGGCCCTGGG + Intronic
1076692452 10:132230720-132230742 GCGCCAGCACCCGCAGCCCAAGG + Intronic
1076836318 10:133022858-133022880 CCGTCAGCCGCGGCGGCTCTGGG + Intergenic
1078317765 11:10306511-10306533 GCGCCGGCGGCCGTAGCCCTGGG - Exonic
1079611031 11:22432745-22432767 CCGCCTCCCGCCGCAGACCCTGG - Intergenic
1080503089 11:32888430-32888452 CAGCCAGCCCCGCCAGCCCTGGG - Intergenic
1080540114 11:33257363-33257385 CCACCAGCCGCCCCAGCCTCGGG - Intronic
1082243267 11:49892351-49892373 CCGCCAGCCGCCTCTTCCCCAGG + Intergenic
1083272951 11:61581166-61581188 CCGCCAGCCGCCGAACGCCGCGG + Intergenic
1085176618 11:74493610-74493632 CCTGCAGCCGCCGCAGCCAGCGG + Exonic
1085784872 11:79440277-79440299 CCTGGAGCCGCCGCAGCCCCCGG - Intronic
1088462121 11:110093128-110093150 CCGCCTCTCGCCTCAGCCCTGGG - Intergenic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1091474043 12:753974-753996 CCTCCAGCCGCTGCCGCCCCTGG + Exonic
1091761873 12:3092926-3092948 TCGCCAGCTCCCCCAGCCCTGGG - Intronic
1101842637 12:108339388-108339410 CAGCTAGCCGCCCCCGCCCTAGG - Intergenic
1102339231 12:112108654-112108676 GCCCCAGCCTCGGCAGCCCTCGG + Intronic
1103356587 12:120325989-120326011 CCGACAGCGGCATCAGCCCTCGG - Exonic
1103764334 12:123270703-123270725 CCGGCTGCGGCCGCAGCCCCAGG + Intronic
1104861550 12:131926818-131926840 CCGCCAGCCTCCGCCTCCCGAGG - Intergenic
1104929182 12:132329298-132329320 CCCGCAGCCCCCGCAGCCCCGGG - Intronic
1104961525 12:132490430-132490452 CCGCCGCCCGCCGCCGCCCAGGG + Exonic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1106597836 13:31161766-31161788 CAGCCAGCCGCCGCTGTCCCCGG - Exonic
1106719986 13:32427492-32427514 CCCCCAGCCTCCCCAGCCCCAGG - Intronic
1107988541 13:45796976-45796998 CTGCCAGCCTCCCAAGCCCTGGG - Intronic
1109545747 13:63838417-63838439 CTTCCGGCAGCCGCAGCCCTGGG + Intergenic
1112056302 13:95691807-95691829 CCGCCAGCCTCCGCCTCCCAAGG - Intronic
1112375522 13:98836509-98836531 CCAGCAGCCACTGCAGCCCTGGG - Intronic
1113794940 13:113051344-113051366 CCGCCCACCGCCGTGGCCCTGGG - Intronic
1114736797 14:25050277-25050299 CCGCGACCCGCCCCAGGCCTCGG + Exonic
1116817681 14:49598947-49598969 CCGCCACCCGGCGCCGCCATCGG - Exonic
1116840987 14:49820861-49820883 CCGCCAGCCTCGGCATCCCAAGG + Intronic
1117803023 14:59464533-59464555 CCGCCAGCAGCTGCAGCGCGCGG + Exonic
1119539117 14:75427631-75427653 GCAGCAGCAGCCGCAGCCCTAGG - Intergenic
1120953281 14:90061412-90061434 CCCTCGGACGCCGCAGCCCTCGG + Intergenic
1121039950 14:90737926-90737948 TGGCCAGCCTCCCCAGCCCTAGG - Intronic
1122270695 14:100567474-100567496 CCACCACCCGCCCCAGCCCCCGG - Intronic
1122297719 14:100714594-100714616 CCACCAGCCTCAGAAGCCCTTGG + Intergenic
1122884336 14:104703911-104703933 CGTCCAGCAGCTGCAGCCCTGGG - Exonic
1123071090 14:105642863-105642885 CCTCCAGCAGCAGCTGCCCTGGG - Intergenic
1123090750 14:105741133-105741155 CCTCCAGCAGCAGCTGCCCTGGG - Intergenic
1123096385 14:105768897-105768919 CCTCCAGCAGCAGCTGCCCTGGG - Intergenic
1123173760 14:106398977-106398999 CGGGCAGCAGCTGCAGCCCTGGG + Intergenic
1123182013 14:106480251-106480273 CGGGCAGCAGCTGCAGCCCTGGG + Intergenic
1202944892 14_KI270726v1_random:16479-16501 CGGGCAGCAGCTGCAGCCCTGGG - Intergenic
1123709100 15:22973536-22973558 CCGCCAGCCACCCCAGCCTCTGG + Intronic
1124322682 15:28726727-28726749 CCGCCCGCCTCCGCCTCCCTGGG + Intronic
1124496996 15:30192833-30192855 CCGCGGGCTGCCGGAGCCCTCGG - Intergenic
1124523513 15:30426861-30426883 CCGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124535154 15:30539353-30539375 CCGCCCGCCTCCGCCTCCCTGGG - Intergenic
1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG + Intergenic
1124952695 15:34338026-34338048 CGCCCAGCCGCCGCAGCCCGCGG + Intronic
1128112679 15:65086562-65086584 CAGGCAGCCTCCCCAGCCCTGGG + Intergenic
1128291456 15:66481616-66481638 CCGCCATCAGAGGCAGCCCTTGG - Intronic
1130428496 15:83822947-83822969 CCGCCAGCCTCCGCCTCCCGAGG - Intronic
1130960468 15:88655498-88655520 CAGCCAGGCGGGGCAGCCCTCGG - Exonic
1130961658 15:88663559-88663581 CCCCCACCCGCCCCAGCCCCAGG + Intergenic
1131174401 15:90201163-90201185 CCGGCGGCCGCCGGAGCGCTGGG - Intronic
1131257923 15:90873658-90873680 CAGCTAGGCGCCCCAGCCCTAGG - Intronic
1131263745 15:90903444-90903466 CCCCCCGCCGCCACCGCCCTCGG - Intronic
1132114661 15:99126530-99126552 CCACCAGCCTCAGCAGACCTGGG - Intronic
1132252018 15:100341474-100341496 CCGCCAGCCGCGCCAGCGCGGGG + Intronic
1132868671 16:2105918-2105940 CGGCCTGCCGCAGCAGCCCTGGG + Exonic
1132869373 16:2108903-2108925 CCGCCACCAGCCCCAGCCCCCGG - Exonic
1134522915 16:14926741-14926763 CGGCCTGCCGCAGCAGCCCCGGG - Intronic
1134549712 16:15133317-15133339 CGGCCTGCCGCAGCAGCCCCGGG + Intronic
1134666403 16:16022127-16022149 ACCCCAGCCGCCCCAGGCCTTGG - Intronic
1134710583 16:16325392-16325414 CGGCCTGCCGCAGCAGCCCCGGG - Intergenic
1134718039 16:16366695-16366717 CCGCCACCAGCCCCAGCCCCCGG + Intergenic
1134718753 16:16369680-16369702 CGGCCTGCCGCAGCAGCCCCGGG - Intergenic
1134949019 16:18343253-18343275 CGGCCTGCCGCAGCAGCCCCGGG + Intergenic
1134956003 16:18382479-18382501 CGGCCTGCCGCAGCAGCCCCGGG + Intergenic
1134956713 16:18385464-18385486 CCGCCACCAGCCCCAGCCCCCGG - Intergenic
1135094733 16:19555649-19555671 CCGCCACTCCCCGCACCCCTCGG - Exonic
1135223960 16:20639413-20639435 CCTCCTGCCTCTGCAGCCCTAGG + Intronic
1136145130 16:28312071-28312093 CCGCCCACCTCAGCAGCCCTTGG + Intronic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136497137 16:30651483-30651505 AGCCCAGCGGCCGCAGCCCTGGG - Exonic
1138104166 16:54278428-54278450 CCTCCAGCCGCTCCAGCCTTGGG + Intergenic
1138660646 16:58515243-58515265 CCGCAAGAAGCCTCAGCCCTCGG + Intergenic
1141634962 16:85309767-85309789 CCGCCAGCCGGCCCAGACCCAGG - Intergenic
1141981083 16:87550873-87550895 CCCCCAGCGTCTGCAGCCCTGGG + Intergenic
1142102637 16:88283769-88283791 CTACCAGCCTCCGCAGACCTCGG - Intergenic
1142102676 16:88283922-88283944 CTACCAGCCTCCGCAGACCTCGG - Intergenic
1142102716 16:88284075-88284097 CTACCAGCCTCCGCAGACCTCGG - Intergenic
1142102734 16:88284147-88284169 CTACCAGCCTCCGCAGACCTCGG - Intergenic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1143587216 17:7856315-7856337 CCGCCTGCCGCTGCTCCCCTTGG + Intergenic
1143742601 17:8965475-8965497 CGAGCAGCCGCCGCAGCCCGAGG - Intronic
1145063820 17:19748724-19748746 CCCCCAGCCACCGCTGCCCCGGG + Intronic
1145413587 17:22694676-22694698 CCGCCAGGCCCAGCAGCCCCTGG - Intergenic
1145417990 17:22740752-22740774 CCGCCAGCCTCGGCCTCCCTAGG + Intergenic
1146048998 17:29533593-29533615 CCGCCAGCCTCCGCCTCCCGAGG - Intronic
1146371134 17:32266153-32266175 CCCGCAGCCGCCGCCGCCCCCGG + Intergenic
1146401344 17:32502392-32502414 CCCCCACTCCCCGCAGCCCTTGG - Intronic
1147926932 17:43952285-43952307 CCTCCAGCCACTCCAGCCCTGGG + Intergenic
1148048749 17:44759156-44759178 CCGCTGGCAGCCGCAGCCCCCGG + Exonic
1148689655 17:49520009-49520031 CCACCAGCTGCCGCAGAGCTGGG - Intergenic
1149330551 17:55576923-55576945 CCTCCAGCCCACGCAGCACTCGG + Intergenic
1149491177 17:57085939-57085961 TCGCCCGCCGGCGCAGCCCCTGG + Exonic
1149678503 17:58487746-58487768 CCAGCAGCCGCCGCCGCCCGCGG - Exonic
1149684304 17:58526712-58526734 CTGCCAGGCCCCGCAGCCCATGG - Exonic
1150250288 17:63700818-63700840 CCGGCAGCCCCCCCAGCCCTCGG + Intronic
1150267770 17:63842299-63842321 CCGCGACCCGCCGCAGCCCGAGG + Intronic
1152135829 17:78502868-78502890 CCCCCACCCGCCTCAGACCTGGG + Exonic
1152230303 17:79110994-79111016 CAGCCAGGAGCTGCAGCCCTTGG - Intronic
1152690705 17:81716527-81716549 CCGCCAGCCCCCGGGGTCCTGGG - Intronic
1152749774 17:82057264-82057286 CCGCCTGCCTCCTCAGCCCCAGG - Exonic
1152784823 17:82242166-82242188 CTGACAGCCCCCGCAGGCCTTGG + Intronic
1153997629 18:10455178-10455200 GCGCCTGCCGTCTCAGCCCTGGG + Intronic
1156326470 18:36078403-36078425 CCGCCAGCCTCGGCCTCCCTAGG - Intergenic
1158357550 18:56638217-56638239 CCGGCAGTCGCCGCAGCCCCAGG - Intronic
1160177880 18:76611030-76611052 CCGCCTGCCGCCACAGCCAGCGG - Intergenic
1160182096 18:76645174-76645196 CCGCCAGCCTCGGCATCCCGAGG + Intergenic
1160662150 19:306197-306219 CCGCGGGCTGCCCCAGCCCTGGG - Exonic
1161130975 19:2588532-2588554 CGTCCAGCTGCCGCCGCCCTGGG - Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161262614 19:3346140-3346162 CAGCCACCCTCCCCAGCCCTGGG + Intergenic
1161282557 19:3453831-3453853 GCGCCAGCCGTGGCAGCCCCGGG - Exonic
1161977064 19:7612784-7612806 CGGCCACCCGGCGCAGCCCTGGG + Exonic
1162363117 19:10231260-10231282 GCCCCAGCCGCGGCCGCCCTGGG - Exonic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1162968820 19:14168087-14168109 CCCCCAGCCTCTGAAGCCCTGGG + Intronic
1163314006 19:16530659-16530681 CCGCCAGCTCCTGCAGCTCTGGG - Exonic
1163347129 19:16750238-16750260 ACGCCAGCCTCAGCCGCCCTGGG - Exonic
1163551170 19:17967152-17967174 GCGCCTGCCGCCGCCGCCCCCGG + Intronic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
1165992849 19:39826056-39826078 CTCCCAGCCGCTGCGGCCCTGGG - Exonic
1166041543 19:40205827-40205849 CAACCAGACGCAGCAGCCCTGGG + Intronic
1166199312 19:41226257-41226279 CCGCCGGCCGGAGAAGCCCTGGG - Intronic
1167294004 19:48638966-48638988 CAGCCGGCCCCTGCAGCCCTTGG - Exonic
1167756516 19:51416518-51416540 CAGGATGCCGCCGCAGCCCTGGG - Intronic
1167975386 19:53222513-53222535 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1168092681 19:54095989-54096011 CCGCCACTCCGCGCAGCCCTGGG - Exonic
1168414505 19:56159906-56159928 CCGGCAGCCCCGGCAGCCCCGGG + Exonic
1168594517 19:57664507-57664529 CGGCCTGCAGCCGCAGCCCCGGG - Intergenic
925984961 2:9207553-9207575 CCGCCGCCCGCCGCCGCCCGGGG + Intronic
926104052 2:10139230-10139252 CCGTCTGCCGCCTCAGCCCTGGG + Intergenic
927552136 2:24010061-24010083 CCGCCCGCGGCCGTTGCCCTCGG - Exonic
931348746 2:61470561-61470583 CCGCAGGCCGCGGCAGCCCGGGG + Intronic
934761892 2:96861123-96861145 CCGCCAGCCACACCAGCCCCAGG + Exonic
934993150 2:98935759-98935781 ACCCCCGCCGCCGAAGCCCTGGG - Intronic
935274379 2:101463559-101463581 CGGTCAGCCACAGCAGCCCTGGG + Intronic
936104710 2:109614392-109614414 CCGCCAGACTCCGCCGCCGTCGG + Exonic
942446171 2:176080309-176080331 GCAGCAGCTGCCGCAGCCCTGGG - Exonic
943713468 2:191124211-191124233 CCGCCAGCCTCCGCGTCCCAAGG - Intronic
945080927 2:206085670-206085692 CCGCCCGCCGTCGCCGCCCGCGG + Intronic
945948136 2:216013672-216013694 CTGCCAGCCTCCGGTGCCCTGGG - Intronic
946053916 2:216885094-216885116 CTGGCAGCTGTCGCAGCCCTTGG + Intergenic
947122932 2:226836153-226836175 CCGCCAGCTCCCGCAGCCCGGGG - Intronic
947724064 2:232386655-232386677 CCGCCAGCTGCCGTAGACCCGGG - Intergenic
947729242 2:232418990-232419012 CAGCCAGCGGCCGCAGACCCGGG - Intergenic
947760448 2:232600112-232600134 CCGGCAGCTACCCCAGCCCTGGG + Intergenic
948669366 2:239558185-239558207 CCGCCTGCTGCCTCAGTCCTGGG - Intergenic
948902436 2:240963379-240963401 CCTGCAGCCTCCGCAGCACTAGG + Intronic
949035229 2:241813108-241813130 CCTCCAGCCACCTCTGCCCTGGG - Intronic
949052092 2:241902862-241902884 CCACCAGCCTCGGGAGCCCTGGG - Intergenic
1170765919 20:19290049-19290071 CCACCAGCAGCAGCAGCCCCTGG + Intronic
1171328740 20:24318821-24318843 CCGGCAGCTGCAGCAGCGCTGGG + Intergenic
1172007130 20:31825174-31825196 GCTCTAGCCGCTGCAGCCCTGGG + Intronic
1173248598 20:41352706-41352728 CTGCCAGCAGCCCCAGCTCTGGG - Intronic
1173322259 20:41998696-41998718 CTGCGCGGCGCCGCAGCCCTGGG + Intergenic
1174317433 20:49713657-49713679 GCGGCAGCCGCAGCAGCCCCCGG + Exonic
1174529536 20:51199934-51199956 CCGCCAGACCTCCCAGCCCTGGG - Intergenic
1175108575 20:56630621-56630643 CCGCCACCCTGCGCCGCCCTGGG - Intronic
1175367717 20:58467216-58467238 CCGCCTGCAGCCGCAGCCCCGGG - Exonic
1175937394 20:62520067-62520089 CCCCCAACCCCCGCAGCCCTCGG + Intergenic
1176179502 20:63742716-63742738 CCGCCTGGAGCCGCAGCCCACGG + Exonic
1180087843 21:45516029-45516051 CCACCACCCGCGGCAGCCCCCGG - Exonic
1181630855 22:24150550-24150572 CCTCCAGCAGCCACAGCACTCGG - Intronic
1184631470 22:45783941-45783963 CCGCCAGCCTCAGCAGACCTAGG - Intronic
1184671345 22:46013664-46013686 CCGCCAGGACCTGCAGCCCTGGG + Intergenic
1184690824 22:46116562-46116584 CCGCCAGCCACCCCCGCCTTCGG + Intergenic
949883924 3:8680028-8680050 CTTCCAGCAGCCCCAGCCCTGGG + Intronic
949987522 3:9552697-9552719 CCGCCAGCCGCCGCCGCCGCCGG - Exonic
950421244 3:12901084-12901106 CGGCCACCCGCCGCTGCCCTCGG - Intronic
952744450 3:36764221-36764243 CCCGCAGCCGCCGCCGCCCCCGG - Intergenic
953589935 3:44241919-44241941 CCGCCAGTCACCACAGCCCGGGG - Exonic
953662897 3:44903931-44903953 CTGCCAGCCGTCGTAGCCCTTGG - Exonic
961414829 3:126749641-126749663 CTGCCAGCCTCAGCAGCCTTGGG + Intronic
966015654 3:175133474-175133496 CCGCCAGCCTCGGCATCCCAAGG - Intronic
966849420 3:184155513-184155535 CCGCCAGCAGCCGCCGAGCTGGG + Exonic
966913006 3:184569620-184569642 CCTCCCGCTGCCGCAGCCCCTGG - Intronic
968081330 3:195848677-195848699 CCACCACCCGCCCCAGCCCCTGG + Intergenic
968433747 4:574925-574947 CTGCGAGACGCCGCGGCCCTGGG - Intergenic
968515139 4:1012543-1012565 CCGCCGGCCGCCGCCGCCCGAGG + Exonic
968658587 4:1789429-1789451 CCCGCAGCAGCCCCAGCCCTAGG + Intergenic
968729059 4:2261323-2261345 CCGGCAGCCCCCGCAGACCCTGG + Intronic
968775395 4:2536856-2536878 CCGCCCTCCGCCGCCGCCCGCGG + Intronic
972532900 4:39977066-39977088 CCGGCAGCCGCCGCTGCGCGTGG - Intronic
977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG + Exonic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
985621921 5:960327-960349 CAGGCAGCCGCCCCAGCCCCTGG + Intergenic
985679781 5:1249817-1249839 CCGCCAGCGGCCTCGGCCATTGG + Intergenic
985713722 5:1444702-1444724 CGGCAAGCCGCCGCCGCCCTGGG + Intronic
985971916 5:3384883-3384905 CCGCCAACCCCAGCAGCCGTGGG - Intergenic
987374215 5:17218564-17218586 GCGCCAGGCGCCTCCGCCCTGGG + Intronic
989264355 5:39455814-39455836 CCGCCGGCGACCGCACCCCTGGG + Intronic
990820908 5:59839254-59839276 CCTCCAGCAGCCACAGGCCTGGG - Intronic
992882714 5:81126564-81126586 CCTCCAACCCCAGCAGCCCTAGG + Intronic
994043580 5:95284547-95284569 TCGCCCGCCGCGGCAGCCCGGGG + Exonic
994367069 5:98928621-98928643 CCCCGAGACGCCGGAGCCCTAGG - Exonic
995895095 5:117002646-117002668 CCGCCAGCCTCAGCCTCCCTAGG - Intergenic
997382645 5:133448723-133448745 CCCCCCGCCCCCGCACCCCTGGG - Intronic
997583978 5:135034036-135034058 CCGCCCGGCGCCGCAGCCCCGGG - Exonic
1001844134 5:174905290-174905312 CAGCAAGCTGCAGCAGCCCTAGG + Intergenic
1002536869 5:179880529-179880551 CTGGCAGCTGCCCCAGCCCTGGG - Intronic
1002559448 5:180071710-180071732 CCGGCAGCCGCCGCTGCTCGCGG + Exonic
1002926814 6:1609827-1609849 CCGCCAGCGGCGGCAGCCAATGG - Intergenic
1003624147 6:7727249-7727271 CCTCCAACAGCCGCAGCCCCCGG + Exonic
1003874865 6:10426285-10426307 CCGCCTCCCGCCGCAGCCCAAGG - Intergenic
1006333702 6:33410152-33410174 CCGCCGGCCACCCCAGCCCCAGG + Intergenic
1006601888 6:35231740-35231762 CTGACAGCCGCCGTTGCCCTCGG - Exonic
1007605362 6:43114037-43114059 CCACCCGCCCCAGCAGCCCTGGG - Intronic
1007825164 6:44594770-44594792 CAGCCAGCAGCTGCAGCCCTAGG + Intergenic
1008624876 6:53305956-53305978 CCGCCAGCCTCGGCATCCCGAGG - Intronic
1011734439 6:90297034-90297056 CCGCCCCCCGCCCCAGCCCCCGG - Intergenic
1011765135 6:90611470-90611492 CCGCCCGGCGCCTAAGCCCTGGG - Intergenic
1013342602 6:109229852-109229874 CTCCCAGCAGCCTCAGCCCTGGG - Intergenic
1013538881 6:111087946-111087968 CAGCCAGCCCCAGCCGCCCTCGG - Exonic
1014137711 6:117907818-117907840 CCCGCCGCCGCCGCTGCCCTCGG - Exonic
1016330275 6:142946572-142946594 CCGCCCGCAGCGGCAGCCGTGGG - Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1017103128 6:150865858-150865880 CCGCCGCCCGCCCCAGCCCCCGG + Exonic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1018400427 6:163414958-163414980 CTCCCAGCCGCCGCCGCTCTCGG - Exonic
1018469054 6:164080383-164080405 CCTCCCGCCTCCGCAGCTCTGGG - Intergenic
1018757473 6:166862687-166862709 CCCCCCGCCTCCCCAGCCCTTGG - Intronic
1019279563 7:193020-193042 GCGCCCGCCGCCGGAGCGCTGGG - Exonic
1020007094 7:4788852-4788874 CCACCAGCTGCTGCAGCCCATGG + Exonic
1020071262 7:5228404-5228426 ACGCCACCAGCCGCAGCCCGGGG - Intronic
1020498768 7:8890202-8890224 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1020831587 7:13102197-13102219 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1021274731 7:18636285-18636307 CTGCCAGCCCCCCCTGCCCTGGG + Intronic
1021735188 7:23636107-23636129 CCGCCAGCCTCGGCCTCCCTAGG + Intronic
1022106264 7:27199875-27199897 CCCCCTGCCGCCGCAGCCGCCGG + Exonic
1022471149 7:30682521-30682543 CCGCCCCCCGGCGCAGCCATTGG - Intronic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1025022124 7:55488394-55488416 CGGCCAGCAGCTGCAGCCTTTGG + Intronic
1026732647 7:72925128-72925150 GCTCCAGCCGCCGCAGCCGCCGG - Intronic
1027111417 7:75442691-75442713 GCTCCAGCCGCCGCAGCCGCCGG + Intronic
1027283646 7:76627224-76627246 GCTCCAGCCGCCGCAGCCGCCGG + Exonic
1028856172 7:95596518-95596540 CCACCAGCCGCCGCCGCCCGAGG + Intergenic
1029139671 7:98400960-98400982 TCGGCCGCCGCCGCAGCCGTCGG + Exonic
1032011829 7:128352105-128352127 CTGGCGGCCGCCGCCGCCCTCGG - Exonic
1033048482 7:137983262-137983284 CAGCCAGCCTCCTCAGTCCTGGG - Intronic
1033159053 7:138981141-138981163 GCGCCCGCCGCCGCCGCCCGGGG - Exonic
1034182387 7:149148343-149148365 CTGCCGGCCCCCGCAGGCCTTGG - Intronic
1034455501 7:151167815-151167837 CCGCCCGCCGCCGCCGCGCCCGG + Intronic
1034501418 7:151453212-151453234 ACCCCAGCTGCCGCAGCCCCTGG - Intergenic
1034879967 7:154756041-154756063 CTGCCAGCAGCCACAGGCCTTGG - Intronic
1035689875 8:1553154-1553176 CCGGCAGCCCCTCCAGCCCTCGG + Intronic
1035744623 8:1952700-1952722 CCGACAGCCGCTGGTGCCCTGGG - Exonic
1036723708 8:11201006-11201028 CCGCCAACCCCCGACGCCCTCGG - Exonic
1037824754 8:22154689-22154711 CAGCCCGCTGCCTCAGCCCTGGG + Intronic
1037878665 8:22561952-22561974 CCGCGCCCCTCCGCAGCCCTCGG - Intronic
1038309342 8:26434094-26434116 CCACCAGCCGCCTCTGTCCTCGG - Intronic
1039542333 8:38382325-38382347 CCGGCAGGCGCCGCGGCCCGCGG - Intergenic
1040481426 8:47831285-47831307 GCGCCAGCCGCCGCCGCCACAGG - Intronic
1040543587 8:48380380-48380402 CCGCAAGGCCCCGCAGCCCCGGG - Intergenic
1040883279 8:52231716-52231738 CCGCCAGCCGCGGCCTCCCAAGG + Intronic
1040915940 8:52565943-52565965 ACGCCAGCCGCCCCTGCCCCAGG + Intergenic
1046375704 8:113377099-113377121 CCGGACGACGCCGCAGCCCTTGG - Intronic
1046423151 8:114011182-114011204 CCGTCCGCCTCCCCAGCCCTTGG - Intergenic
1049405406 8:142449964-142449986 CCTCCAGCCGCCGCCGCCCCCGG - Exonic
1049415467 8:142492927-142492949 TCGCCGGCCGCGGCAGCTCTCGG + Intronic
1049510510 8:143024656-143024678 CCGGCAGCCACAGCAGGCCTGGG + Intergenic
1049532401 8:143160840-143160862 CCACCAGAAGCCGCAGCCCCAGG + Intergenic
1052633673 9:31072084-31072106 CCACCAGCAGCTGCAGACCTAGG - Intergenic
1056554557 9:87677816-87677838 CAGCCTTCCGCAGCAGCCCTGGG - Intronic
1057242490 9:93423637-93423659 CCCCCAGCCACTGCTGCCCTTGG - Intergenic
1057314363 9:93959090-93959112 CCTCCATCCGCCTCAGCCGTGGG + Intergenic
1057740496 9:97707074-97707096 CCTCAAGCCTCCTCAGCCCTGGG + Intergenic
1060520389 9:124290832-124290854 CCGCCAGAAGCAGCAGCCATGGG + Intronic
1060770152 9:126326739-126326761 CGGCCCGCCGCCGCGGCCCGCGG + Intergenic
1061142965 9:128779761-128779783 CCGCCAGCCTCGGCATCCCGAGG + Intergenic
1061280965 9:129597470-129597492 GCGCCAGCGGCCCCAGCGCTCGG - Intergenic
1061403573 9:130381745-130381767 CCGCCAACCACCACAGCCCCAGG + Intronic
1061806372 9:133139728-133139750 CCACCAGCTCCCGCTGCCCTTGG - Intronic
1061873553 9:133533054-133533076 CCGCCAGGCCTCGCACCCCTTGG - Intronic
1062317929 9:135977649-135977671 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062317944 9:135977685-135977707 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062317959 9:135977721-135977743 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062317987 9:135977793-135977815 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062318002 9:135977829-135977851 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062318016 9:135977865-135977887 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062318030 9:135977901-135977923 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062318043 9:135977937-135977959 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062318056 9:135977973-135977995 CCTCCACCCCCAGCAGCCCTGGG + Intergenic
1062462990 9:136669620-136669642 CCGCCTACCGCCGCAGCCCTGGG + Exonic
1062699477 9:137891445-137891467 TCGCGAGCCGCCACAGGCCTGGG - Intronic
1189861329 X:45275739-45275761 CAGCAAACCGCAGCAGCCCTAGG - Intergenic
1190322229 X:49186105-49186127 CCTCCAGCAGCCCCAGCCCCAGG + Intronic
1191666444 X:63707470-63707492 CCGCCACCCCCCACAGTCCTAGG + Intronic
1195954796 X:110317832-110317854 GCCGCCGCCGCCGCAGCCCTGGG + Exonic
1199177131 X:144802309-144802331 ACTCCAGGCTCCGCAGCCCTTGG - Intergenic
1199699484 X:150365012-150365034 CCGGCCGCCACCGCAGCTCTGGG + Intronic
1200053717 X:153447567-153447589 CCGCCAGCCTGCCCAGACCTGGG + Intronic
1200086641 X:153610329-153610351 CCGCCCCCCGCCGCAACCCCGGG - Intergenic
1200277860 X:154751159-154751181 CCTCCGGCCGCCGCGGCCCCCGG + Intronic
1201073552 Y:10170657-10170679 CCGCCAGCCGACACGGCCGTGGG + Intergenic