ID: 977910147

View in Genome Browser
Species Human (GRCh38)
Location 4:102524891-102524913
Sequence CTGTATATACAGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 11, 2: 15, 3: 26, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977910147 Original CRISPR CTGTATATACAGATGAAGCT TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901104977 1:6748163-6748185 CTGTTTATATAGACAAAGCTTGG - Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904483862 1:30811223-30811245 CTGTCTATGCAAATAAAGCTTGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905351340 1:37348634-37348656 CGGGATACACAGATGAACCTGGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
907789173 1:57645072-57645094 CTGTGGATCCAGATGAACCTTGG - Intronic
908087758 1:60654395-60654417 CTGGATCTACTGCTGAAGCTAGG - Intergenic
908263112 1:62353924-62353946 CTGTATTTCCAGCTGAAACTGGG - Intergenic
908377180 1:63555467-63555489 TTGTATATAGAGATGAAACAGGG + Exonic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
911386638 1:97183674-97183696 ATGTATATACAGATCAATCCAGG + Intronic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
911666543 1:100559283-100559305 CTTTATTTGCAGATGAAGCCTGG - Intergenic
912780174 1:112539130-112539152 CTATATATACATTTAAAGCTTGG - Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
919524821 1:198634288-198634310 CTGTCCATACAAATCAAGCTGGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1071214340 10:83381849-83381871 TTGTATCTACAGATCAAGTTGGG - Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1085928227 11:81048220-81048242 GTGTATATATATATGAAGATTGG - Intergenic
1085928231 11:81048384-81048406 GTGTATATATATATGAAGATTGG - Intergenic
1085928232 11:81048429-81048451 GTGTATATATATATGAAGATTGG - Intergenic
1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG + Intronic
1091515366 12:1174898-1174920 CTGTATATACAGGTATACCTCGG + Intronic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1093534688 12:20209643-20209665 CAGTATATACCCATGAAGCAAGG - Intergenic
1093612525 12:21179830-21179852 CTGTATCTACATATAAAGATGGG - Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1098387198 12:69931972-69931994 CTGTATATACAGATATCTCTGGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099111374 12:78565896-78565918 CTATACATACTGATGTAGCTTGG - Intergenic
1100308555 12:93373408-93373430 CTGCATATAAACATGATGCTTGG + Intergenic
1101345778 12:103884976-103884998 ATGTGTATAAAGATGATGCTGGG - Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1106553688 13:30792346-30792368 CTGTACATAAAGATGACACTGGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1108781391 13:53840369-53840391 TTGTTTATACAGTTGAAGTTTGG - Intergenic
1110109877 13:71732671-71732693 CTGTATTTACAAATAAAGGTAGG - Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1123418308 15:20109190-20109212 CTATATATACAGATGTCGTTAGG + Intergenic
1123527526 15:21115724-21115746 CTATATATACAGATGTCGTTAGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG + Intergenic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1126611737 15:50536870-50536892 TTGTATTTACAGATCAAGTTGGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1128947098 15:71832577-71832599 CTGTATATAACAATCAAGCTTGG - Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG + Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1146226783 17:31073985-31074007 CTATATATACTAATGAATCTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147047093 17:37760885-37760907 CTTAATAGACAGTTGAAGCTGGG - Intergenic
1149669682 17:58395328-58395350 TTGTATATACATTTAAAGCTAGG - Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151114636 17:71721705-71721727 CTGCGTATACAGAGTAAGCTGGG + Intergenic
1151416741 17:73971243-73971265 CTGTAAATACCCATGAATCTGGG - Intergenic
1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157319985 18:46626775-46626797 TTGTCTATAAGGATGAAGCTAGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1160055488 18:75475570-75475592 CTCTATAAACAGATGAATCCTGG - Intergenic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1167031662 19:46966051-46966073 CTGGATGTACAAGTGAAGCTAGG - Intronic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
928561836 2:32496517-32496539 CTGTATGAACAAATGAGGCTGGG - Intronic
929148757 2:38729496-38729518 CTCTATATAAAGATGAGACTTGG + Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933958522 2:87393110-87393132 CTATATATACAGATGTTGTTAGG - Intergenic
934242652 2:90285079-90285101 CTATATATACAGATGTTGTTAGG - Intergenic
934270524 2:91531583-91531605 CTATATATACAGATGTTGTTAGG + Intergenic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
939766753 2:146260203-146260225 CTAAATATAAAGAAGAAGCTGGG - Intergenic
940081296 2:149805040-149805062 CTGTATTAACTGAGGAAGCTAGG + Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
943148084 2:184071515-184071537 CTCAATATAAAGATCAAGCTTGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
1171843348 20:30242246-30242268 CTGTTTATGGAGATGTAGCTAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG + Intergenic
1181350426 22:22251927-22251949 CTATATATACAGATGTCGTTAGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183257242 22:36770483-36770505 TTGGATATACAGACAAAGCTTGG - Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
950155983 3:10722053-10722075 ATGTTTATGCAGGTGAAGCTAGG + Intergenic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
951533070 3:23716351-23716373 CTGAATCTATAGATCAAGCTGGG + Intergenic
956272445 3:67462353-67462375 CTGTCTATACAGATGCTTCTTGG - Intronic
959784703 3:110281662-110281684 ATGTATATATAGATGAGTCTTGG + Intergenic
963767117 3:149348933-149348955 CTGTTTATACTGATGCATCTTGG + Intergenic
963982069 3:151549451-151549473 CTGGATATAAAGAAGAAGATAGG - Intergenic
964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG + Intergenic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
967714377 3:192745446-192745468 TTGTCTATACAGTTGAACCTTGG + Intronic
969598909 4:8164177-8164199 CTGTATTTAGAGATGAAGAAAGG - Intergenic
969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG + Intergenic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972635016 4:40876520-40876542 CTGTATATACCGTTGTCGCTTGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
976986831 4:91311112-91311134 ATGTATTTACAGAAGAAGATAGG + Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983896891 4:173090698-173090720 CAGTATATGTAGATAAAGCTGGG + Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984545964 4:181102934-181102956 CGCTTTATACACATGAAGCTAGG + Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG + Intergenic
987998000 5:25310660-25310682 AGTTATATACAGATAAAGCTAGG - Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989665164 5:43845775-43845797 CCTTATCTACATATGAAGCTGGG + Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
991682366 5:69151791-69151813 CTGTATATATAGATTAGGCCAGG + Intergenic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992858616 5:80889827-80889849 CAGAATATACACTTGAAGCTCGG - Intergenic
993914119 5:93720924-93720946 CAGAATATACACATGAAGGTGGG - Intronic
994207389 5:97050640-97050662 CTGTATTTAAGGAGGAAGCTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
998215128 5:140232271-140232293 TTGTATATAAACCTGAAGCTTGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000200124 5:159001014-159001036 CTATATATATTTATGAAGCTGGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004765173 6:18718278-18718300 CTTTAGATGCAGATAAAGCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007438131 6:41832375-41832397 CAGTACATACATATGTAGCTAGG - Intronic
1010357101 6:74947194-74947216 CTGTGTAAACCGAAGAAGCTAGG - Intergenic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG + Intronic
1031295751 7:120001244-120001266 CTGAATCTACACATCAAGCTGGG + Intergenic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1032773124 7:135079758-135079780 ATGTATAAAAAGATGAGGCTGGG - Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1035193029 7:157189159-157189181 CTGAATATGCCGAGGAAGCTGGG + Intronic
1035409407 7:158626977-158626999 CTAAATTTACAGATCAAGCTGGG - Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1043000327 8:74751839-74751861 CTGTATAAACAGATGACTGTAGG + Intronic
1043558387 8:81461110-81461132 CTGTCTATAAATTTGAAGCTGGG + Intronic
1043806977 8:84683845-84683867 CTTAATATACAGAATAAGCTGGG - Intronic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG + Intergenic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051161748 9:14216445-14216467 CTGTGGATACAGATGCACCTTGG - Intronic
1051279582 9:15428295-15428317 CTGTTTATACAGATCAACTTTGG + Intronic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1058140824 9:101355354-101355376 CTGTATCAAAAGAGGAAGCTTGG - Intergenic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1060446464 9:123693106-123693128 GTGTATATATAGATGAATTTTGG + Intronic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1188357724 X:29212964-29212986 CTGAATATACAGTTGACTCTCGG - Intronic
1188667900 X:32847044-32847066 CTATATATACACAAGAAGATTGG - Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1191735339 X:64382998-64383020 CTGTATTTAAGGGTGAAGCTTGG - Intronic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG + Intergenic
1199406914 X:147472876-147472898 TTGTATATAGAGATGAACCTAGG - Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200023147 X:153228780-153228802 CTGTACATGCAGTTGAACCTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic