ID: 977912851

View in Genome Browser
Species Human (GRCh38)
Location 4:102557882-102557904
Sequence CCTTTTTACCAGATACTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977912848_977912851 -5 Left 977912848 4:102557864-102557886 CCTCTTAGTGGTTAGATTCCTTT 0: 1
1: 1
2: 1
3: 8
4: 143
Right 977912851 4:102557882-102557904 CCTTTTTACCAGATACTGTAGGG 0: 1
1: 0
2: 1
3: 8
4: 115
977912847_977912851 -1 Left 977912847 4:102557860-102557882 CCTACCTCTTAGTGGTTAGATTC 0: 1
1: 0
2: 1
3: 5
4: 70
Right 977912851 4:102557882-102557904 CCTTTTTACCAGATACTGTAGGG 0: 1
1: 0
2: 1
3: 8
4: 115
977912845_977912851 27 Left 977912845 4:102557832-102557854 CCTTCACTTTCTCACAGCTGGCA 0: 1
1: 0
2: 2
3: 27
4: 254
Right 977912851 4:102557882-102557904 CCTTTTTACCAGATACTGTAGGG 0: 1
1: 0
2: 1
3: 8
4: 115
977912844_977912851 28 Left 977912844 4:102557831-102557853 CCCTTCACTTTCTCACAGCTGGC 0: 1
1: 0
2: 1
3: 13
4: 227
Right 977912851 4:102557882-102557904 CCTTTTTACCAGATACTGTAGGG 0: 1
1: 0
2: 1
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977912851 Original CRISPR CCTTTTTACCAGATACTGTA GGG Intronic
906996059 1:50795562-50795584 CATTTATACCACATACTTTAAGG - Intronic
911532141 1:99056405-99056427 GCTCTTTACCAGACTCTGTAGGG - Intergenic
911753850 1:101529958-101529980 CCTTTTTCCCAGATGCTCTCAGG - Intergenic
920174352 1:204090844-204090866 CCTTTGCACCAGGTGCTGTAAGG + Intronic
923481457 1:234389030-234389052 TGTTTTGACCAGATACTGTAAGG + Intergenic
924733283 1:246731687-246731709 ACTTTGTACTATATACTGTAGGG + Intronic
1064092474 10:12396483-12396505 CCTTTTTGCCATATGCTGTGGGG + Intronic
1066173576 10:32879309-32879331 TTTATTTAGCAGATACTGTATGG - Intronic
1067297113 10:44980969-44980991 CCTTTTTAGCAGATAGTGCAAGG + Intronic
1067659902 10:48226930-48226952 CCTCATTGCCAGAAACTGTAAGG - Intronic
1067705874 10:48606107-48606129 CCTCTTTACCAGCTACTGAAAGG - Intronic
1079162866 11:18011248-18011270 CCTTCTTTCCAAATACAGTAAGG - Intronic
1083379195 11:62251069-62251091 ACTTTTAACCACATACTATAGGG + Intergenic
1085379713 11:76103762-76103784 CCTCATTACCAGATTCTTTAAGG + Intronic
1085840940 11:80011320-80011342 CCTTGTTGCCAGACACTATATGG - Intergenic
1087968798 11:104453422-104453444 CCTTTATACCATACACTTTATGG + Intergenic
1088384878 11:109242539-109242561 CTTTTTCACCACACACTGTATGG - Intergenic
1089023063 11:115238331-115238353 CTATTTTACCAAATGCTGTAAGG - Intronic
1094225197 12:28037669-28037691 TCTTTTAACTTGATACTGTATGG - Intergenic
1094370350 12:29730832-29730854 CCTTTTGAACAAATACTGAATGG - Intronic
1094828097 12:34287565-34287587 CCTTTCCAGCAGATGCTGTATGG + Intergenic
1100971595 12:100076749-100076771 CTTTTTAATTAGATACTGTAAGG - Intronic
1105612221 13:21978295-21978317 CCTTTTTATCACATTCTGCAAGG + Intergenic
1108427133 13:50313748-50313770 TCTTTTGACCAGAAAATGTATGG + Intronic
1114079633 14:19192475-19192497 CCAATTTACCAGATTCTTTATGG - Intergenic
1119590135 14:75879060-75879082 CCTTTCTACTAGTCACTGTAGGG + Intronic
1120051489 14:79872084-79872106 CCTCTGTGCCAGACACTGTAAGG - Intergenic
1120261082 14:82187183-82187205 TCCTTTTATCATATACTGTATGG + Intergenic
1121504818 14:94469020-94469042 CATGTTTACCAGTTACAGTAGGG - Intronic
1124358891 15:29019876-29019898 GCAGTTTACCAGATACTGTCAGG + Intronic
1129177786 15:73852570-73852592 CCCTTTTCCCATAAACTGTAAGG + Intergenic
1132174481 15:99699677-99699699 ACTTTTGACTGGATACTGTAAGG + Intronic
1134478274 16:14595055-14595077 CATCTTGACTAGATACTGTAAGG + Intronic
1137895035 16:52202882-52202904 TCATCTAACCAGATACTGTATGG + Intergenic
1138988354 16:62359827-62359849 CCTTTTTATAAGATAATGTTGGG - Intergenic
1140561262 16:75984924-75984946 CCATTTTTCCAGATACTGCCTGG - Intergenic
1140875301 16:79145963-79145985 CCTTTTTAGCTGATATTTTATGG - Intronic
1141118316 16:81330870-81330892 CATTTTTAGCAGATACACTACGG - Intronic
1141218412 16:82046348-82046370 CCTATGTGTCAGATACTGTAAGG + Intronic
1141727902 16:85801832-85801854 ACTTTGTACCAGACACTGTTAGG + Intronic
1147872930 17:43600357-43600379 TGTTTTTACCAGATAGTGAAAGG + Intergenic
1151193754 17:72417070-72417092 CCCTTTTACCATATACCATAAGG - Intergenic
1155015426 18:21834026-21834048 CCTTTTTCCCAGTAACTCTACGG + Intronic
1156951407 18:42904303-42904325 CCTTTTCAGCAGATACACTATGG + Intronic
1158402599 18:57134442-57134464 CCTTTTTAACAGTTAATGAAAGG - Intergenic
925693310 2:6547923-6547945 ACTTTTTAGAAGATACTATAGGG + Intergenic
927151438 2:20198643-20198665 CCTTTCTCCCAGATGCTGTGGGG + Intergenic
932812245 2:74834916-74834938 CCTTTTTCCCTGTTACTGGAGGG + Intronic
934550558 2:95258787-95258809 CCTCATCACCAGAAACTGTAGGG + Intronic
935446604 2:103163459-103163481 CATTTCTACCAGACACTCTAAGG - Intergenic
936266064 2:111008085-111008107 TGTTTTGACTAGATACTGTAAGG - Intronic
940458372 2:153931237-153931259 GCCTTTTAGCAGAGACTGTAGGG + Intronic
942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG + Intergenic
942932230 2:181508807-181508829 CTTTTCTAACAGATACTGAATGG - Intronic
943497859 2:188647040-188647062 CCTTTTTAACTGATACTTGAAGG + Intergenic
1170543100 20:17408510-17408532 ACTTTTGACCATATGCTGTAGGG + Intronic
1170711070 20:18791547-18791569 CCTTTTTACAACATCCTGGAGGG - Intergenic
1171501540 20:25597393-25597415 TATTTTAACCAGAAACTGTAAGG - Intergenic
1173187659 20:40853469-40853491 CCTTTTTACCAGCTGGTGAATGG - Intergenic
1177407794 21:20692843-20692865 CCGTTTTACCAGAGCCTGTGGGG + Intergenic
1180501135 22:15930225-15930247 CCAATTTACCAGATTCTTTATGG + Intergenic
1181176092 22:21036972-21036994 CCTTGTCACCAGAAACTGTAGGG - Intergenic
1182161422 22:28125964-28125986 CATTTTTTCCAGATCCTCTAAGG - Intronic
1182242741 22:28929740-28929762 CCTTGTTATCTGATACTGTTGGG + Intronic
1182871506 22:33651594-33651616 GCTGTTTACCAAATACAGTATGG - Intronic
1184591412 22:45486106-45486128 ACTGTTTGCCAGATACTTTAAGG + Intergenic
949707961 3:6840573-6840595 CCTTATTACCAGAAACTGTAGGG + Intronic
949749493 3:7334380-7334402 CCTTTTTAGTAGATCTTGTAGGG - Intronic
951467347 3:23016074-23016096 CCATTTAACAATATACTGTATGG - Intergenic
955079201 3:55642166-55642188 CCTCTTTGCCTGATAGTGTAAGG - Intronic
955993155 3:64650210-64650232 CTTTTTAACCAGATGGTGTAAGG - Intronic
957147553 3:76443583-76443605 CCTTTTCTCCAAATACTGCAGGG + Intronic
960366078 3:116774375-116774397 CCTATTTTCCAGATGCTGTATGG - Intronic
960505651 3:118490104-118490126 TCTTTCTACTAGATACTGTCTGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
965307835 3:167089379-167089401 ACTTTATACCAGATACTGATTGG + Intergenic
969793389 4:9507622-9507644 CAATTTTACCAGAGACTGTGAGG + Intergenic
973749142 4:53995365-53995387 CCTTTTTTCCTGAAACTGAAAGG - Intronic
975982067 4:80172323-80172345 CCTTTTTACAAGAAAGTGTTGGG + Intergenic
976306061 4:83560567-83560589 GCTTTTTCCCAGATACTTAAAGG - Intronic
977912851 4:102557882-102557904 CCTTTTTACCAGATACTGTAGGG + Intronic
980578763 4:134720811-134720833 CCTTTTTAATAAATACTGTTGGG + Intergenic
983190381 4:164747813-164747835 CCTTTTTCCCAAACACTGTTTGG - Intergenic
983990866 4:174118086-174118108 ACTTATTACCAGAGGCTGTAAGG - Intergenic
989338329 5:40346043-40346065 CCTTTCTACCAGTTACCTTAAGG - Intergenic
989427460 5:41313211-41313233 CTTTTTAATCAGATGCTGTATGG - Exonic
990148509 5:52789197-52789219 CTTTTTTACCAGTTACTGATTGG + Intronic
990816229 5:59788491-59788513 ACTTTGTTCCTGATACTGTACGG - Intronic
991712883 5:69425468-69425490 GCTTTTTTCCAGATACTAAAAGG + Intronic
994287576 5:97988547-97988569 ACTTTTTACCATATACAGCAGGG + Intergenic
996310897 5:122103530-122103552 CCTTTGTACCAGAAACAGTGTGG - Intergenic
996748969 5:126870375-126870397 TTTATTTAGCAGATACTGTATGG - Exonic
997071338 5:130626203-130626225 GCTTTTGACCTGATACTTTATGG - Intergenic
1000023477 5:157338897-157338919 CCTTGTCACCTGCTACTGTAAGG + Intronic
1000412943 5:160952962-160952984 GTTTTTTACCAGATACTTTGTGG + Intergenic
1002682622 5:180979555-180979577 CCTTTGTTCCAGATGCTTTAGGG + Intergenic
1003709985 6:8578663-8578685 CCTTTTTACCACAGAATGTGTGG - Intergenic
1004800391 6:19140541-19140563 CCTTATTACCAGATTCTCTTTGG + Intergenic
1004820509 6:19363202-19363224 GCTTTTTAACAGATTCTGAAAGG + Intergenic
1008840769 6:55900667-55900689 CCTAGTTACCAGATTCTGGAAGG + Intergenic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1012481150 6:99668586-99668608 CCTTTGTACCAGGTAATTTAAGG - Intergenic
1014106736 6:117572845-117572867 TCTTAGTACCAGATAATGTATGG - Intronic
1021717884 7:23475427-23475449 CCTTTTCTCCAGATAATGAAAGG - Intergenic
1032551285 7:132786862-132786884 ACTTTCTACCAGATACTATTTGG - Intronic
1033345532 7:140523087-140523109 CCTTTTAAACAGGTACTTTAAGG + Intronic
1033793065 7:144815786-144815808 TATTTTGACTAGATACTGTAAGG + Intronic
1034696671 7:153059995-153060017 CCTTTTAACCAGCTACAGAAAGG - Intergenic
1035551007 8:525198-525220 CATTTTTGCCAGATAATCTAGGG - Intronic
1039969079 8:42306419-42306441 ACTTCTTACCAGGTACTGCAGGG - Exonic
1041463512 8:58137090-58137112 CCTTTTAGCCAGAAACTGCATGG + Intronic
1041475929 8:58266020-58266042 CCTTCTTATCAGAAACTGTAAGG + Intergenic
1045930316 8:107617229-107617251 CCTTTTTTTCAGTTACTGTTTGG - Intergenic
1052001691 9:23290280-23290302 CCTTTTGATCATATATTGTATGG + Intergenic
1056058134 9:82850855-82850877 CCATTTTAAGAGTTACTGTAGGG - Intergenic
1056750174 9:89344704-89344726 CCTTCTTAGCAGTTGCTGTAGGG + Intronic
1058489443 9:105480917-105480939 CCTTTTTTCAAGATTCTATATGG + Intronic
1186414808 X:9373808-9373830 CGTTTTTACCACATGCTGTTGGG + Intergenic
1186631625 X:11355662-11355684 CCTTTTTACCACATTCAGAATGG - Intronic
1186723414 X:12330039-12330061 CCTTTTTACAGGATTCTGTGGGG + Intronic
1188340904 X:29000189-29000211 TGTTTTTACCGGATACTGCATGG + Intronic
1189961922 X:46332482-46332504 CCTTGTTCCAAGATACTGCAGGG - Intergenic
1193338208 X:80315473-80315495 CTTTTTTTCCAGATGCTGCAGGG - Intergenic
1193866941 X:86744618-86744640 CAGTTTTACCAGATACAGTAAGG - Intronic
1201958820 Y:19656006-19656028 GCTTTCTACCAGAGACTATAGGG + Intergenic