ID: 977913773

View in Genome Browser
Species Human (GRCh38)
Location 4:102567071-102567093
Sequence GTGGGAAAACACTGTGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977913766_977913773 -4 Left 977913766 4:102567052-102567074 CCTGCATGCCCACAGCCTGGTGG 0: 1
1: 0
2: 1
3: 27
4: 353
Right 977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG 0: 1
1: 0
2: 0
3: 21
4: 272
977913764_977913773 -1 Left 977913764 4:102567049-102567071 CCACCTGCATGCCCACAGCCTGG 0: 1
1: 0
2: 9
3: 56
4: 499
Right 977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG 0: 1
1: 0
2: 0
3: 21
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977913773 Original CRISPR GTGGGAAAACACTGTGAGGA TGG Exonic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900520104 1:3101280-3101302 GTGGGAAAAGCCTGAGATGAGGG + Intronic
900899166 1:5505141-5505163 GTGTGAGAACACAGTGAGAAGGG + Intergenic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
903850542 1:26303157-26303179 TTGGGAAAGTACTGTGAGGGTGG + Intronic
903952695 1:27005421-27005443 TTGGGTAATCACTGGGAGGAGGG - Exonic
905703385 1:40036241-40036263 GTGGGAAAACTTTCTGGGGATGG + Intergenic
907484487 1:54767760-54767782 GTGGTAAGAAGCTGTGAGGAGGG + Intergenic
909164651 1:72204316-72204338 GAGGGAAAAAATGGTGAGGAAGG - Intronic
909427088 1:75537685-75537707 TTGGGAATACAAGGTGAGGAGGG + Intronic
910172749 1:84395944-84395966 CTGGGAAGACACTGTTAGGTTGG - Intergenic
910603383 1:89055583-89055605 GAGGGAGAAAACTGTGGGGATGG + Intronic
910637332 1:89423531-89423553 GAGGGAGAAAACTGTGGGGATGG - Intergenic
911130300 1:94380973-94380995 GTGGGGGCAAACTGTGAGGAAGG - Intergenic
913501334 1:119475297-119475319 GTGGGTCAACAGTGTGGGGAGGG + Intergenic
914217472 1:145645313-145645335 GTGGGAAAAATCAGAGAGGAGGG + Intronic
914470041 1:147967998-147968020 GTGGGAAAAATCAGAGAGGAGGG + Intronic
915910820 1:159914164-159914186 GGGGGAAAAAAATGGGAGGAGGG - Intergenic
917981027 1:180269299-180269321 GTGACAAAACGCTATGAGGAAGG - Intronic
918439886 1:184556199-184556221 GTTGGATAACACTGTGGGGTGGG + Intronic
924431936 1:244004582-244004604 CTGGGAATACACTGTTAGGTTGG + Intergenic
924553547 1:245099696-245099718 GTGAGAAGACGATGTGAGGAAGG + Intronic
924879710 1:248146882-248146904 TATGGAAAACACTGTGAAGATGG - Intergenic
1063162155 10:3426352-3426374 GTGGAAAAATACTGTGAGAAAGG + Intergenic
1064267543 10:13837098-13837120 ATGGGAACACATGGTGAGGATGG + Intronic
1065746295 10:28845584-28845606 GTAGCAAAACACTATGAGGAAGG + Intergenic
1066286452 10:33971158-33971180 GGGGGAAAAAAATGTGAGGAAGG - Intergenic
1066654728 10:37687076-37687098 GTGGTCAAACACTGTCAGGGAGG + Intergenic
1068682818 10:59838499-59838521 GTGTGAAAATAGTATGAGGAAGG - Intronic
1074527117 10:114272328-114272350 TTAGGAAAACTGTGTGAGGAAGG - Intronic
1076913497 10:133404516-133404538 CTCGGAAAACACTGTTAAGAGGG - Intronic
1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG + Intronic
1077597536 11:3546915-3546937 GTGGAATGACGCTGTGAGGAGGG - Intergenic
1077930255 11:6723923-6723945 GTGGGAAAACTCTGAGCAGATGG + Intergenic
1078019026 11:7640179-7640201 GAGGGAAAACAATGCTAGGAAGG - Intronic
1081498470 11:43640183-43640205 TAGGAAAAACACTGTGGGGAGGG + Intronic
1082680391 11:56161375-56161397 GTAATAAAACACTGTGAAGATGG + Intergenic
1083129977 11:60615938-60615960 TTTGGAAAACACTGTGACTATGG - Intergenic
1083580628 11:63822899-63822921 GTGGGCAAAGTCTGAGAGGAAGG + Intronic
1083999487 11:66288438-66288460 CTGAGAAAAAACTGTGATGAGGG + Intronic
1084409511 11:68998372-68998394 GTGGGATGACACCGTGAGGTTGG + Intergenic
1084455791 11:69267558-69267580 TTAGGAAAACACTGAGCGGAAGG + Intergenic
1084463784 11:69310514-69310536 GTGGGAAAAGACTAGGAGGACGG + Intronic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085384296 11:76148230-76148252 GTGGAAATACACAGTGAGGCTGG - Intergenic
1085408428 11:76277671-76277693 GGGGCAAACCACTGTGCGGATGG - Intergenic
1086556184 11:88113787-88113809 GTTTGTAAACACTGTGATGATGG + Exonic
1088095077 11:106089972-106089994 GTTGGAAAACATTTTGAAGAAGG + Intronic
1088336008 11:108704711-108704733 GTGTTAAAATACTATGAGGAAGG + Intronic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089818957 11:121204139-121204161 GTTGGAATACAGTGAGAGGAAGG - Intergenic
1091630960 12:2160604-2160626 GTTGGAAATTACTGTGATGATGG - Intronic
1093558455 12:20507888-20507910 TTGTGAATACACAGTGAGGAAGG - Intronic
1093961592 12:25279294-25279316 GTGGGAAGGGACTGTGAGGGTGG + Intergenic
1094106796 12:26821283-26821305 CGGGGAAATCACTGTGAGCAGGG - Intronic
1095050572 12:37550670-37550692 ATGGGAAAAGACTGTAATGATGG + Intergenic
1095404182 12:41849493-41849515 GTGGGAAAGGACTGGGAGAAGGG - Intergenic
1097249200 12:57623124-57623146 GTGGGAAAACACAGGTAAGAGGG + Exonic
1098777310 12:74636783-74636805 TTGAGAAAACATTGTGAGGTGGG - Intergenic
1098784627 12:74735920-74735942 GTGGGAGTAAACTGTGAGGATGG - Intergenic
1102381138 12:112467836-112467858 GTGAGAACTCACTGTGAGGATGG + Intronic
1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1104984319 12:132587960-132587982 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1105353223 13:19634322-19634344 TTTGGAAAACACTGTAACGATGG - Intronic
1105683145 13:22750943-22750965 GTGTTAAAATACTGTGAGCACGG + Intergenic
1108685084 13:52812626-52812648 ATGGGAAAATATGGTGAGGAGGG - Intergenic
1108697788 13:52917974-52917996 GTGGGAAAACAGTTTAGGGAAGG + Intergenic
1108701600 13:52948679-52948701 GTGGGAAGACTCAGTGAGGTGGG + Intergenic
1110040142 13:70744633-70744655 ATGAGAAAACAATGTGAGGATGG - Intergenic
1110335307 13:74323302-74323324 GTGGGAAAACACTAAAAAGAAGG - Intergenic
1113284302 13:108829627-108829649 ATGAGAAAAGACTATGAGGAGGG + Intronic
1113421539 13:110174975-110174997 GTGGGATAAAACAGAGAGGATGG - Intronic
1115444535 14:33474204-33474226 GGGGGAAAAGACTGTTAGAAAGG + Intronic
1118380905 14:65216843-65216865 ATGGGAAAACACTTGGAGGGTGG - Intergenic
1119718309 14:76874291-76874313 GTGGAACACCACTGTAAGGAGGG - Intergenic
1120674491 14:87405094-87405116 ATGGGAAGACACTGGGAAGAAGG + Intergenic
1121093832 14:91202158-91202180 CTGTGAAAACCCTGTGAGGCAGG + Intronic
1121465023 14:94110254-94110276 GCTGGTAAACTCTGTGAGGATGG + Intronic
1121720058 14:96103034-96103056 GTGAGCACACACTGTGAGTAAGG - Intergenic
1122244552 14:100393211-100393233 GTGTAAATACACTGTGAGTAGGG - Intronic
1123008691 14:105336699-105336721 GTGGGAGGCCACTGTGGGGAGGG + Intronic
1123452068 15:20374166-20374188 GTGGAAACACATTGTGAGGGTGG - Intergenic
1125437459 15:39662156-39662178 GGGGGAAAGGGCTGTGAGGAGGG + Intronic
1125633836 15:41170646-41170668 GTGTGAGAACAGTGTGAGAAGGG + Intergenic
1125781742 15:42274810-42274832 TTGGGAGACCACTGGGAGGATGG + Intronic
1127733172 15:61818691-61818713 GAGGGAACACTCTGTGGGGATGG - Intergenic
1127903901 15:63361729-63361751 GTGGGAGAACACAGTCAGGAGGG + Intronic
1129072760 15:72964711-72964733 GTGGTAAAACTATGTGAGGATGG + Intergenic
1129913963 15:79251621-79251643 GAGGCTAAACACGGTGAGGAGGG - Intergenic
1130039857 15:80397428-80397450 GTAGGAAATGACTGTGAGGCTGG + Intronic
1130346201 15:83047898-83047920 GTGGGAAGACACTGGAAGCAAGG + Intronic
1136541383 16:30929303-30929325 GTGTTAGAATACTGTGAGGATGG + Intronic
1137406742 16:48195078-48195100 TTGGGAAAAGACTGTGGGCACGG - Intronic
1139027879 16:62841524-62841546 GAGGGAAGGCACAGTGAGGATGG + Intergenic
1140513320 16:75524171-75524193 GTGGGATAGCACTGTCAGGCTGG - Intergenic
1141666802 16:85469942-85469964 GCGGGGAACCACAGTGAGGATGG - Intergenic
1142158218 16:88542639-88542661 GTGGGAAGACATTGTCAGGGAGG + Intergenic
1143576077 17:7794147-7794169 GGAGGAAAACAGTGCGAGGAGGG - Intronic
1144461115 17:15459352-15459374 GTGAGAGAACAGTGTGGGGAGGG - Intronic
1144575840 17:16428828-16428850 CTGGGACACCACTGTGAGCAGGG - Exonic
1145005020 17:19332818-19332840 TTGGGGAAACCCCGTGAGGAAGG - Intronic
1145722596 17:27088053-27088075 GTGGGAAGAAACAGTGGGGAAGG - Intergenic
1148482859 17:47971337-47971359 GGCGGGAAACACGGTGAGGAGGG - Intronic
1148603270 17:48909350-48909372 CTGGGAAAAGACTGTGTGGAGGG - Intronic
1148848856 17:50544595-50544617 ATGGGAAGACACTGTCAAGATGG - Intronic
1149525449 17:57351985-57352007 GTGAAGAAACACTGAGAGGAAGG + Intronic
1149788267 17:59454675-59454697 GTGGGCAAACCCTGTTAGAAAGG - Intergenic
1150430176 17:65108943-65108965 GCGGGAAATAACTCTGAGGAGGG + Intergenic
1153776952 18:8462850-8462872 GTGACAAAAAACTCTGAGGATGG + Intergenic
1155896357 18:31332902-31332924 GTGGTAAAGCACTGTAAGAAAGG + Intronic
1156769669 18:40704063-40704085 GTTGAATAACACTGTGAGGAAGG - Intergenic
1157866776 18:51194873-51194895 GTGGAGGAACAATGTGAGGAGGG - Intronic
1159204777 18:65235511-65235533 GTGTGAAAACCCCCTGAGGAAGG + Intergenic
1161019280 19:2000399-2000421 GTGGGGAAAACCTTTGAGGAGGG + Intronic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1162509011 19:11105875-11105897 TTGGGAAATCACTGTTTGGAAGG + Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1163845305 19:19635203-19635225 GTCAGAAAGCACTGTGGGGAAGG + Exonic
1164684080 19:30155796-30155818 TTGGGGAAACATTGAGAGGAGGG - Intergenic
1165274884 19:34740397-34740419 GTGGGAACACAGTGTGATAATGG - Intronic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1168557532 19:57355560-57355582 GTGGGAAAACACCCAAAGGATGG - Intronic
1168583684 19:57576093-57576115 GTGGGAAGACACAGTGATGATGG - Intronic
925426985 2:3757932-3757954 GGGGGAAAGCACTGTGAGAGTGG + Intronic
925871162 2:8271907-8271929 ATGGGAAGACATTGAGAGGATGG + Intergenic
926603906 2:14877216-14877238 GTGCGAAAACACAGCTAGGATGG - Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
928217259 2:29371947-29371969 GTGGGTAATCACTATGAGCAGGG + Intronic
928730432 2:34225564-34225586 GAGACAAGACACTGTGAGGAGGG + Intergenic
930369530 2:50485697-50485719 GTGGTAAGAGTCTGTGAGGAGGG + Intronic
930679219 2:54238322-54238344 ATGGGATACAACTGTGAGGAGGG - Intronic
930989613 2:57636802-57636824 GTGGGAAACCACTGTTTGGGTGG + Intergenic
933793267 2:85900529-85900551 GCAGGAAAACACTGAGAGGGTGG - Intergenic
934159194 2:89232060-89232082 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934167542 2:89308016-89308038 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934208078 2:89950365-89950387 GGGGGCAGAGACTGTGAGGAAGG - Intergenic
934798000 2:97119070-97119092 GAGGGAAAATACTGTGGAGAGGG + Intronic
934835422 2:97584368-97584390 GAGGGAAAATACTGTGGAGAGGG - Intronic
935658044 2:105441647-105441669 GTGGGAAAACCCTGTTATGGGGG + Intergenic
936032398 2:109082719-109082741 GCAGGAAAACTCTGTGAGGTTGG + Intergenic
936344562 2:111665352-111665374 ATGTGGAAACACTGTGAGGTGGG - Intergenic
938251922 2:129822080-129822102 GTGGGGAAACATTATGAAGAAGG - Intergenic
940433550 2:153623266-153623288 GAGGGAAAGCACGTTGAGGAAGG - Intergenic
942433301 2:175940410-175940432 GTGAGAAAACTATCTGAGGATGG + Intronic
943317364 2:186406826-186406848 GTGGGAAATCACTGGGGGGGGGG - Intergenic
943971798 2:194419138-194419160 GGGGAAAAATACAGTGAGGAAGG + Intergenic
945972248 2:216242392-216242414 CTGGGAAAACACGGTGCGGAGGG - Intergenic
946015869 2:216603322-216603344 GGGTGAATACAGTGTGAGGAAGG + Intergenic
946064014 2:216970665-216970687 GTGGGGAAGCTCTATGAGGATGG - Intergenic
948061230 2:235044537-235044559 GTGGGAAAACCCTGTGACCTTGG + Intronic
1169212800 20:3777240-3777262 GTTGGAGAACACTGTGAGGGTGG + Intergenic
1170706224 20:18746874-18746896 GCAGGAAAACACAGTGATGAGGG - Intronic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171545085 20:25994144-25994166 ATGGGAAAAGACTGTAATGATGG + Intergenic
1172105602 20:32515520-32515542 GTGGGTGCACACTGAGAGGATGG + Intronic
1173189267 20:40863680-40863702 GTGAGAACACCCTGTGAAGATGG + Intergenic
1173311523 20:41900480-41900502 GTGAGAAAACACTGTTAGTCAGG - Intergenic
1175326868 20:58135693-58135715 GTGGGAAATCGCTGTCAGGAAGG + Intergenic
1175649316 20:60704015-60704037 GTGGGATAAAACTGAGAGCATGG - Intergenic
1175804398 20:61819454-61819476 GTGGAAAATCACAGTGTGGAGGG - Intronic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176955557 21:15099023-15099045 GTGGCAAAACACTGTCAGCCAGG - Intergenic
1177279148 21:18956584-18956606 GGTGTAAAACAATGTGAGGAAGG - Intergenic
1179461073 21:41535802-41535824 TTGGAATAACACTGGGAGGAGGG + Intergenic
1181030321 22:20146301-20146323 GTGGGAAAGCACACTGGGGAGGG + Intronic
1182666533 22:31964330-31964352 GTGGGAAACCAGTGTGGGGCTGG + Intergenic
1183321820 22:37169651-37169673 GGGGGCAAACCCTGGGAGGAGGG - Intronic
1183337098 22:37256157-37256179 CTGGGAAAACCCTGTCAGGCTGG - Intergenic
1183642996 22:39103629-39103651 GTGGGACACCACAGGGAGGAAGG - Intronic
949163885 3:913792-913814 GTGGGAAAACAAAGTGGGGAGGG - Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
950156241 3:10723624-10723646 ATGGGAAAGCACTGGGAGGGTGG + Intergenic
952383037 3:32818877-32818899 CTCGGGAAACACTGAGAGGATGG - Exonic
953514878 3:43580203-43580225 GTGGGAAAACATTTTGATGGAGG - Intronic
954306382 3:49727716-49727738 CTGGGCAAACACTGTCTGGAAGG + Intronic
956179173 3:66501267-66501289 GTGGGAAAAGAGTGTGGGGGCGG - Intergenic
957846460 3:85743087-85743109 GTGGGAAACCACTGGGAACAGGG - Intronic
961772303 3:129258841-129258863 GTGGGAATACCCTGTCAGGGAGG + Intronic
962134495 3:132720441-132720463 GTTGGAAACAACTGTGAGGTGGG - Intronic
962564533 3:136644218-136644240 GTGGTGAAAAACTTTGAGGATGG + Intronic
963638020 3:147823876-147823898 GTGGCAAAACAAAGTGAGCAAGG - Intergenic
966664060 3:182450770-182450792 GAGATAAAACACAGTGAGGAGGG - Intergenic
968720207 4:2196967-2196989 GTGGGAATGCACTGAGAGGCCGG + Intronic
970215192 4:13751661-13751683 ATGGGCAAACCCAGTGAGGACGG + Intergenic
971261090 4:25057537-25057559 GTGGGACAAGAGGGTGAGGAGGG + Intergenic
972757278 4:42061022-42061044 ATGGTAAAACACTGTAATGATGG - Intronic
973938811 4:55881629-55881651 GTGGGACAACAAAGTGGGGAGGG + Intronic
974237715 4:59203854-59203876 GTAGGAAAACACTGAGAGAAAGG - Intergenic
975552899 4:75631071-75631093 GAGGGAAAACACTGAGATGGAGG + Intergenic
976616537 4:87083711-87083733 GTGGGGAAACACAGTAATGATGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977274880 4:94964684-94964706 ATGGGAAACCACTGTTAGAATGG + Intronic
977877402 4:102165597-102165619 GGGAGAAAACACTAAGAGGATGG + Intergenic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
982116713 4:152104281-152104303 GTGGGAAGTCCATGTGAGGACGG + Intergenic
985212824 4:187613335-187613357 GTGGGAAAGCTCTGTAGGGACGG + Intergenic
985531029 5:433950-433972 GCGGGAAAGCACAGTGAGGATGG + Exonic
985696970 5:1346152-1346174 GTGAGAAGACTCTGTGGGGAGGG - Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
991065268 5:62417834-62417856 GGAGGAAAACAATGTCAGGAAGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992822111 5:80507795-80507817 ATGTGAAAACACTGTGAAGGTGG - Intronic
995143758 5:108763373-108763395 GTGACAAAACAATGTGATGAGGG + Intronic
995749224 5:115436825-115436847 GTGGGAAATCACTATGGGGAGGG - Intergenic
999297991 5:150472582-150472604 GTGGGAACCCACTGAGAGCATGG - Intergenic
1001144690 5:169173544-169173566 CTGGGAAAATAATGTGAGGAAGG - Intronic
1001407473 5:171486072-171486094 GTGGGGGAACACTGTCAGGTGGG + Intergenic
1002254706 5:177950624-177950646 GAGGTAAAACACTGAGAAGATGG - Intergenic
1002323466 5:178389529-178389551 GTGGGCACCCTCTGTGAGGAGGG - Intronic
1002364120 5:178696894-178696916 CTGGGAAAACACCGCGAGAAAGG + Intergenic
1002963361 6:1938469-1938491 GTGGGAAAATACTGTCAGCATGG - Intronic
1003282704 6:4708015-4708037 GTTGGAAAACATTGTCAGAATGG + Intronic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1007094636 6:39205673-39205695 GTGGGACAACAGTGTCAGTAGGG + Intronic
1007139528 6:39556641-39556663 GTGGGAGAACAAGGTTAGGAAGG + Intronic
1007351960 6:41280624-41280646 GTGGGAAAGCACTCTGAGTGAGG - Intronic
1007901338 6:45416077-45416099 GGGGAAAAACACTGAGAGAACGG + Intronic
1008517717 6:52333958-52333980 GGATGAAAACACTGTGAGAAAGG + Intergenic
1010336884 6:74695717-74695739 TGGGGAAAACATTGTGAGGGGGG + Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1011704345 6:89985941-89985963 GTGGGAAGACAGTGTGGGGCTGG + Intronic
1012193032 6:96303989-96304011 CTGTGAAAACACTGAAAGGAAGG + Intergenic
1013807580 6:114012340-114012362 GTGGCAAAAAACTTTGGGGATGG + Intergenic
1014762880 6:125377309-125377331 GTGGGAAAACACAAAGACGAAGG + Intergenic
1015036043 6:128655873-128655895 GTGAGGAAACTCTCTGAGGATGG - Intergenic
1015660915 6:135572371-135572393 GAGGCAATACTCTGTGAGGATGG + Intergenic
1016000075 6:139033008-139033030 ATGGGAACACACAGTGAGGGAGG + Intronic
1017577906 6:155826079-155826101 GTGGGGAAACACAGCAAGGAAGG - Intergenic
1018584494 6:165341106-165341128 GAGGGGAAAGATTGTGAGGATGG + Intronic
1019156905 6:170045280-170045302 GTGGGAAAGCACCCTGAGCACGG + Intergenic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1021446149 7:20735768-20735790 AGGGGAAAACACAGAGAGGAAGG + Intronic
1022728430 7:33001086-33001108 GTGTGAAAACACTGAAAAGAAGG - Intronic
1023547632 7:41335556-41335578 GTGGCAAGAAACTGCGAGGAAGG - Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024226879 7:47332201-47332223 TTGGGACACCACTGTGAGGCAGG + Intronic
1024899075 7:54296313-54296335 GTGGGAATGCTCTGTGAGGCAGG - Intergenic
1025296494 7:57779213-57779235 ATGGGAAAAGACTGTAATGATGG + Intergenic
1026011889 7:66642847-66642869 GTGGGAACAAACAGTGAGTATGG + Exonic
1028270843 7:88787148-88787170 GTGAGAAAAGACTATGAGAAAGG + Intronic
1029227385 7:99038032-99038054 GTGGAAAAAAACTGAGAGGGTGG + Intronic
1030247142 7:107395357-107395379 TTGGGAAAACACAGTGAGTTGGG - Intronic
1031236918 7:119188687-119188709 GTGGTCAAAAACTGTGAAGAGGG + Intergenic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1031840161 7:126728249-126728271 GTGGCACAGCACTGTGAGAATGG - Intronic
1031867818 7:127058583-127058605 GAAGGAAAACAATTTGAGGAAGG - Intronic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1033773765 7:144583168-144583190 ATGAGAAAACACTGGGAGCAAGG - Intronic
1035142685 7:156779021-156779043 GTGGCAAAACACTGTAAACAAGG + Intronic
1036959841 8:13232143-13232165 GTGGCAAAACAATGTCACGAAGG + Intronic
1037585268 8:20271616-20271638 GTGGGAAAGAACCGAGAGGATGG - Intronic
1037765852 8:21771814-21771836 GTGGGGAAAGACTGTGGGTAGGG - Intronic
1038823169 8:30971971-30971993 GAGAGAAAACACTGGGGGGAAGG + Intergenic
1039741194 8:40384453-40384475 GACAGAAAACAGTGTGAGGATGG + Intergenic
1040529487 8:48254579-48254601 GTGGGAACAAACTGGGGGGAGGG + Intergenic
1041195324 8:55396155-55396177 GTGGTAAAACATTTTGTGGAAGG - Intronic
1042051581 8:64715310-64715332 GTGGAAAATCACTGTGAACAGGG + Intronic
1042966033 8:74352982-74353004 GAGGAAAAACAGTGTAAGGAGGG - Intronic
1045123858 8:99067932-99067954 ATGGGAAAACAATGGGAGCATGG - Intronic
1046360546 8:113148287-113148309 ATGGCAAAAGGCTGTGAGGAGGG - Intronic
1046700226 8:117392294-117392316 GTGCAAACACACTGTAAGGATGG + Intergenic
1047398273 8:124523796-124523818 GAGGGAAGACAGTGTAAGGAAGG + Intronic
1048635126 8:136287073-136287095 GTGAGGACACAGTGTGAGGATGG + Intergenic
1050243497 9:3661999-3662021 GGAAGAAGACACTGTGAGGAAGG - Intergenic
1050580901 9:7055230-7055252 GTGCTACACCACTGTGAGGACGG - Intronic
1053152420 9:35751445-35751467 ATGGGAAAACAATGAGGGGAAGG - Intronic
1053525623 9:38827559-38827581 GTGGGAGATCTCTGTGATGATGG - Intergenic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1054197856 9:62051993-62052015 GTGGGAGATCTCTGTGATGATGG - Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1054640499 9:67536379-67536401 GTGGGAGATCTCTGTGATGATGG + Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055173043 9:73284276-73284298 GAAGGAAGACACTGTGTGGAGGG + Intergenic
1055563700 9:77547219-77547241 GTGGGGAAACACAGTGAAAAAGG + Intronic
1056936678 9:90919972-90919994 GAGGGAAAACTATGTGGGGAAGG - Intergenic
1057581345 9:96290167-96290189 GTGGGAAAAAATTGTGGAGAGGG - Intronic
1057790774 9:98123430-98123452 GTTGGAATACAGTGTGGGGAAGG + Exonic
1057915273 9:99050569-99050591 GTGAGAAAACCCAGTGGGGAGGG + Intronic
1059180168 9:112204577-112204599 GTGGAAAAACACTCTGTGCATGG - Intergenic
1060038821 9:120282098-120282120 GTGGAAAAACAAAGTGACGATGG + Intergenic
1060187507 9:121572727-121572749 GAGGCAAAACAGTGTGAGGCTGG + Intronic
1185827696 X:3268010-3268032 TTGGGAAAAAAATATGAGGATGG - Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1189396295 X:40625634-40625656 GTGGGAGGACAATATGAGGATGG + Intergenic
1191689148 X:63921967-63921989 GTGGGAATACTCTGTGAGATGGG + Intergenic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1196017776 X:110957705-110957727 GTAGGAAAACACCATGAGCAAGG - Intronic
1198373377 X:136013691-136013713 TTGGGAAAACACTGAGAAAAAGG - Intronic
1200793990 Y:7323930-7323952 GTGGGAGGACAGTGTGAGAAGGG + Intergenic
1201673930 Y:16558173-16558195 CTGGGGAAGCACTGTCAGGAAGG - Intergenic
1201738619 Y:17299674-17299696 GGAGGAAAACACTGTAAAGAGGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202585084 Y:26415055-26415077 GAGGGAAAATACTGTGGAGAGGG + Intergenic