ID: 977914531

View in Genome Browser
Species Human (GRCh38)
Location 4:102577001-102577023
Sequence ATTTGCAAGCAGAAGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977914524_977914531 -9 Left 977914524 4:102576987-102577009 CCCTGACCTTGCCTATTTGCAAG 0: 1
1: 0
2: 1
3: 8
4: 143
Right 977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 357
977914523_977914531 8 Left 977914523 4:102576970-102576992 CCTGGACTCTTGGTGCACCCTGA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 357
977914525_977914531 -10 Left 977914525 4:102576988-102577010 CCTGACCTTGCCTATTTGCAAGC 0: 1
1: 0
2: 0
3: 4
4: 113
Right 977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977914531 Original CRISPR ATTTGCAAGCAGAAGGTGGA GGG Exonic
901587437 1:10309505-10309527 ATTAGCAAGCAATAGCTGGAAGG - Intronic
903345936 1:22684402-22684424 TTTTGCAAGCAGGAGGTTGGTGG + Intergenic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905168302 1:36096425-36096447 AATTGGAACCAGAGGGTGGAAGG + Exonic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908768011 1:67571542-67571564 ATTTGCCAGCTGAAGGAGAAGGG + Intergenic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
911222777 1:95266960-95266982 TTTTTCAAGCAGGAAGTGGATGG - Intergenic
911295592 1:96110993-96111015 ATTTGAAAGGAGAAGGTACAAGG + Intergenic
911429518 1:97766418-97766440 ATTTGCAAGCAGATTTTAGAGGG + Intronic
913944046 1:125140442-125140464 ATTTGGGAGCCCAAGGTGGATGG - Intergenic
914097123 1:144553544-144553566 ATTTTCAAGCAGAACATGAAAGG - Intergenic
914301871 1:146384066-146384088 ATTTTCAAGCAGAACATGAAAGG + Intergenic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
916106760 1:161438709-161438731 GTTTGCAAGCATGAGGAGGAAGG + Intergenic
916593713 1:166221013-166221035 ACTTGAAGGCAGAAGGTGGGAGG - Intergenic
918066233 1:181103902-181103924 ATTTGCAAGCTGTAGGAGGTGGG - Intergenic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG + Intergenic
918611363 1:186496123-186496145 ACTGGCAAGGAGAAGGTGAAAGG + Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
919064918 1:192682630-192682652 ATTGGCAAGTAGGAGGTGGAAGG - Intergenic
919345877 1:196377647-196377669 CTTTGCAAGCAGAAAGAGAAGGG + Intronic
919635604 1:200000369-200000391 ATTTGCAAGGCCAAGGTGGCTGG - Intergenic
920699332 1:208205690-208205712 ATATGCAAGCAGAGACTGGATGG - Intronic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923737318 1:236622924-236622946 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
923972181 1:239216917-239216939 ATTTGGAAGAATGAGGTGGAAGG + Intergenic
924262803 1:242249278-242249300 ATTTCATGGCAGAAGGTGGAAGG - Intronic
924315643 1:242792606-242792628 ATTAGGGAGCGGAAGGTGGAAGG - Intergenic
1064254034 10:13729064-13729086 ATTTGGGAGTAGGAGGTGGAGGG - Intronic
1065095403 10:22275745-22275767 ATTTGAACCCAGGAGGTGGAGGG + Intergenic
1065960922 10:30733551-30733573 ATTTGCACTCAGATGGTAGAAGG + Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066725435 10:38387652-38387674 ATTTCATGGCAGAAGGTGGAAGG + Intergenic
1067479264 10:46584697-46584719 GTATGCAAGCAGAAACTGGATGG - Intronic
1067615475 10:47757104-47757126 GTATGCAAGCAGAAACTGGATGG + Intergenic
1069064148 10:63925009-63925031 ATTTGAGATCAGAAGGTGTATGG + Intergenic
1069428941 10:68315736-68315758 TTGTGCAAGCAGAAAGTGAAAGG + Intronic
1070114812 10:73518049-73518071 ATTTGCAAGTAGAATGTGATTGG - Intronic
1071260444 10:83914622-83914644 TTTGGCAAGTGGAAGGTGGATGG - Intergenic
1072699873 10:97633114-97633136 GTTAGCGAGCAGAGGGTGGAGGG - Intronic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1077212420 11:1377684-1377706 AGTTGCAAGCAGATGGGGGATGG + Intergenic
1077385031 11:2264983-2265005 ATCAGCGAGCAGGAGGTGGAGGG + Intergenic
1078422313 11:11222794-11222816 ACTTGAAACCAGAAGGTGGAGGG - Intergenic
1080677069 11:34438439-34438461 ATTTGCAACCAAAGGATGGATGG - Intergenic
1081156259 11:39695691-39695713 AGTTGCCAGCAGAACATGGAAGG - Intergenic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1083513871 11:63237454-63237476 ATCTCACAGCAGAAGGTGGAAGG - Intronic
1084106267 11:66982829-66982851 ATGTGCAAGCAGTATGTGCAAGG - Intergenic
1084984173 11:72852985-72853007 ACTTGAAGGCAGAAGGTGGGAGG + Intronic
1085472517 11:76767366-76767388 GTTTTCAAGCAGAAGCTGGGTGG + Intergenic
1085594350 11:77794437-77794459 CTTTGCAAGGACAAGGTGGGAGG + Intronic
1087897524 11:103603316-103603338 ATTTGGGAACAAAAGGTGGATGG - Intergenic
1090038903 11:123273148-123273170 ATTTGAATGCAGAAGGTTTATGG - Intergenic
1090449938 11:126797440-126797462 TTCTGCAAGCAGAAGTTGAAGGG - Intronic
1091181731 11:133611011-133611033 ATTTGCAGGCAGAAGGTAAAAGG - Intergenic
1091527026 12:1313136-1313158 TTTTGCAAGCAGGAGGAAGAAGG - Intronic
1092913548 12:13169190-13169212 ATGTGCAGGCAGGAGGTGGCTGG + Intergenic
1093091229 12:14922984-14923006 ACTTGAACCCAGAAGGTGGAGGG + Intronic
1095107700 12:38255294-38255316 ATTTGCAAGGCTAAGGTGGGAGG + Intergenic
1096257785 12:50073534-50073556 ATTTGCAGGAGGAAGGGGGAAGG - Intronic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1104154725 12:126120451-126120473 ATTTTCAACCAGATGGAGGAAGG - Intergenic
1106087352 13:26555507-26555529 AAATGCAAGCAGAAGGTGCTGGG + Intergenic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1107508248 13:41057263-41057285 ACTTGCAAGCCTAAGGTGGGAGG - Intronic
1108279594 13:48848284-48848306 ATTTGCAATCAGCAGCTAGAAGG - Intergenic
1109789046 13:67224364-67224386 AGTAGCAAGGAGAAGGGGGAGGG - Intronic
1110189791 13:72717226-72717248 ATTTCCAAGCAAATTGTGGAAGG - Intronic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1112379882 13:98878811-98878833 TTTTGCTGGCAGAAGGTTGATGG - Intronic
1112400742 13:99076187-99076209 TTTTGCAAGGAGCACGTGGATGG - Intronic
1112454442 13:99545859-99545881 ATTTGAAAGCAGGAGTTGGCTGG - Intronic
1112660828 13:101505753-101505775 ATTAGCAAGCAGGAAGAGGAAGG - Intronic
1112943590 13:104896649-104896671 AGCTGCAAGCATGAGGTGGAAGG + Intergenic
1113063967 13:106355715-106355737 ATTTGCTATCAGAAGGCTGAAGG + Intergenic
1113184228 13:107668491-107668513 TTTTGCAAGCAGAAGCTAGTTGG + Intronic
1114145755 14:19975763-19975785 GTTTGCAAGCAGAAAGTACATGG - Exonic
1114276412 14:21149629-21149651 ATTTTCAAGCAGAATGTTTAAGG - Intergenic
1114959739 14:27870883-27870905 ATTTCCAAGCACAAAGTGAAAGG + Intergenic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1118202922 14:63693839-63693861 ATTTGCAAGGCCAAGGTGGGAGG - Intronic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1119005689 14:70925718-70925740 ATTTGAAAGCATATGGTGCATGG - Intronic
1119655202 14:76412537-76412559 GTTTGCAAGGAGGAGGAGGATGG - Intronic
1119795637 14:77394236-77394258 ATTTGCCAGCAGTAGGTAGCTGG - Exonic
1121002031 14:90458226-90458248 CTTTTCAAGCAAAAGGTGAAGGG + Intergenic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1123685664 15:22795387-22795409 AGCTGCAAGCAGATGGTGGCTGG + Intronic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1125586730 15:40825920-40825942 TTTTGCAAGATGAAAGTGGAGGG - Intronic
1125770467 15:42162143-42162165 GTTTGCTGGCAGAAGGTTGAGGG + Exonic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126559460 15:50027213-50027235 ATTTGACAGCAGTAGGTGCAAGG - Intronic
1127233622 15:57023404-57023426 TTTTTCAAGCAGAATGGGGAGGG - Intronic
1127611268 15:60639898-60639920 ATTTGCAAGAAAAGGGTAGAAGG + Intronic
1127778464 15:62289283-62289305 TTTTGCAAGGACCAGGTGGATGG + Intergenic
1128167474 15:65478822-65478844 TGTTGGAAGCAGAAGGTGGGAGG - Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1129057366 15:72830329-72830351 ATTTCCAAGCAAAATATGGAAGG - Intergenic
1129080352 15:73033842-73033864 ACTTCCTAGCATAAGGTGGAAGG + Intergenic
1129346288 15:74921942-74921964 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1133131825 16:3680813-3680835 ATCTTCATACAGAAGGTGGAAGG - Intronic
1133849781 16:9491614-9491636 ATTTGCAAGGAGACTGTGGAGGG + Intergenic
1134021817 16:10926283-10926305 ATTTACAAGCTGAACCTGGATGG - Exonic
1135346888 16:21696369-21696391 ATTTGGATGCAGAAGGGGTAAGG + Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136945875 16:34650379-34650401 ATTTGGAAGACCAAGGTGGAAGG - Intergenic
1137583347 16:49648277-49648299 ATTTCCAAGCAAACTGTGGAAGG + Intronic
1139635126 16:68253930-68253952 ATTTGCAAGGCCAAGGTGGGAGG - Intronic
1140641204 16:76975612-76975634 ATTTGGAATCAGAATTTGGAAGG - Intergenic
1140891920 16:79292097-79292119 TTTTCCAAGCAGAAGCTGTAGGG + Intergenic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1141731345 16:85825075-85825097 ATTTGCAGGCACCAGGGGGACGG - Intergenic
1142174013 16:88636713-88636735 GTATGCAAGCAGAGGGTGGGTGG + Intergenic
1142521382 17:507286-507308 TTCTGCAAGCAGAGGGTGAAAGG + Intergenic
1143903712 17:10193785-10193807 AGTTGCAATCAGATGGTGGCTGG - Intronic
1144461851 17:15464660-15464682 GTTTGAAAGCAGAAGGGGAAGGG - Intronic
1146111440 17:30093663-30093685 ATTGGAAAGCAGAAAGTGGTGGG - Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150668304 17:67166201-67166223 ATTTCCAAGTAGAAGTTGAATGG - Intronic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1152212262 17:79009028-79009050 ATTTGAAGTCAGAAGGTGGTGGG + Intronic
1153635155 18:7107037-7107059 ATGAGCAAGCAGAACGTAGATGG + Intronic
1153765214 18:8368119-8368141 TTATGCAAGCAGAAGGTAGTGGG - Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1153967860 18:10197774-10197796 TTTTTCTAGAAGAAGGTGGAGGG + Intergenic
1154096698 18:11423527-11423549 ATTAGAAGGCAGAAGATGGAGGG - Intergenic
1154462885 18:14613382-14613404 GTTTGCAAGCAGAAAGTACATGG - Intergenic
1155039706 18:22054727-22054749 GTTTGCAAGCAGAATTTGGAGGG - Intergenic
1155041506 18:22069118-22069140 ATGTGTAAGCAGAAGCTGTAGGG - Intergenic
1155090462 18:22504253-22504275 ACTTGCAAGCAGAAGATGGTGGG - Intergenic
1155103004 18:22632316-22632338 ATTTGCTAGGGAAAGGTGGAAGG - Intergenic
1155449020 18:25944019-25944041 TTCTGCAAGCACAGGGTGGATGG - Intergenic
1155710748 18:28875661-28875683 ATTTGCAAGCAGAAGTTGGCTGG + Intergenic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1156889649 18:42175985-42176007 ACTTGAAAGCATGAGGTGGAAGG - Intergenic
1157332758 18:46715351-46715373 AATTGCCAGGAGCAGGTGGAGGG + Intronic
1157487717 18:48100441-48100463 ATTAGCAAGCTGGAGGAGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157967467 18:52224383-52224405 ATCTCATAGCAGAAGGTGGAAGG - Intergenic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1159141424 18:64399942-64399964 CTTAGCACGCAGAAGGTTGAGGG + Intergenic
1160561431 18:79759926-79759948 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1162433143 19:10641478-10641500 AGCTGAAAGCAGAAGGTCGATGG + Intronic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1163359057 19:16834080-16834102 ATTTGCAAACAGGAAATGGAAGG - Intronic
1163468738 19:17484881-17484903 ATTTTGATGCAGAAGCTGGAGGG + Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164794771 19:31016907-31016929 ATTTCCAAGGAGAAGCTGGCTGG - Intergenic
1164897142 19:31886747-31886769 GTTTGCAAGCAGATGGTAAAAGG - Intergenic
1165610366 19:37146425-37146447 ATTTGAGAGCTGAGGGTGGAGGG + Intronic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167911697 19:52708752-52708774 ATTTGAACTCAGGAGGTGGAGGG + Intronic
1202682532 1_KI270712v1_random:20548-20570 ACCTGCAAGGAGAAGGAGGACGG - Intergenic
925614957 2:5736005-5736027 ATTTTCATGAAGAAAGTGGAGGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
928058530 2:28084462-28084484 GTTTGAAAGCAGAACTTGGATGG + Intronic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
929803723 2:45126721-45126743 ATTTGCATTCACAAAGTGGAGGG + Intergenic
929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG + Intergenic
929849281 2:45568682-45568704 ATTTTCAAGCAGAAATTAGAAGG + Intronic
930256112 2:49093838-49093860 ATTTGGAAGGCCAAGGTGGATGG - Intronic
930480685 2:51944430-51944452 TTTTGCAGGCTGTAGGTGGAAGG + Intergenic
931988630 2:67766786-67766808 ATTTGCAAGAAAAAAGTGAAAGG + Intergenic
932584210 2:73014482-73014504 ATTTTCAAGAATAAGGTGGTGGG - Intronic
938505226 2:131873143-131873165 ATTTGCATGGAGTCGGTGGAGGG - Intergenic
939687919 2:145222840-145222862 ATTGGCACTCAGAAGGTGGGTGG - Intergenic
939822941 2:146979731-146979753 ATTTGCAAGCAGTAGATTCAGGG - Intergenic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940838568 2:158553087-158553109 ATTTCCAAGCAGAGCGTAGAAGG + Intronic
941897574 2:170644924-170644946 ATATGAAATCAGAAGGTGCAGGG + Intronic
942054513 2:172169819-172169841 ATTAGCCACCAGAAGCTGGAAGG + Intergenic
942884842 2:180910595-180910617 ATATTCAAGCAGAAGGTAGAGGG + Intergenic
943573532 2:189602882-189602904 ATTTGAAAGGAGAAGGAGGTTGG - Intergenic
944515100 2:200505153-200505175 ATTTGTAAGCAGAGGGTTGCTGG - Intronic
945284262 2:208066317-208066339 ATGTCCAAGCAGAATGTAGAAGG + Intergenic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
947328444 2:229002903-229002925 ATTTCCAAGCAGAGTGTTGAAGG - Intronic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948314496 2:237016916-237016938 AGATGCTAGCAGAAGGTGGGAGG - Intergenic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
948625210 2:239264285-239264307 ATTTGCAAACCGAAGCTGAATGG - Intronic
949021128 2:241742061-241742083 AGATGCAGGCAGAGGGTGGAAGG + Intronic
1170487404 20:16832767-16832789 AGATGCAAGCTGAAGGAGGAGGG - Intergenic
1172394223 20:34588167-34588189 ACTTGAAACCAGGAGGTGGAGGG + Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1174591441 20:51648393-51648415 ATGTGCAGAGAGAAGGTGGAAGG + Intronic
1175375743 20:58522764-58522786 ACTTGCAAGCTGATGGTGGGGGG - Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176114684 20:63426609-63426631 ATTTCCAAGCAAAGTGTGGAAGG - Intronic
1176787871 21:13280736-13280758 ATTTGCATGGAGTCGGTGGAGGG + Intergenic
1177969147 21:27766996-27767018 ATTTGCAAGCTGAAGGTTTTGGG + Intergenic
1178505544 21:33159817-33159839 CATTGCAAGCAGCAGGTGGGAGG + Intergenic
1179140896 21:38724027-38724049 GTTTGTAAGCAGAATTTGGAGGG + Intergenic
1179311865 21:40203265-40203287 ATCTGCAAACATAAGGTGGAAGG - Intronic
1179323448 21:40315889-40315911 ATTGGCAAGCAAAAGGAGGAGGG + Intronic
1179418268 21:41215566-41215588 GTTTTCCAGCAGAAGCTGGATGG - Intronic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
1185196783 22:49476726-49476748 CTTTGCAACCAGTGGGTGGATGG + Intronic
949233169 3:1775293-1775315 ATTTCCAAGCAAAATGTTGAAGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950279534 3:11694734-11694756 GTTTGCAAGATGAAAGTGGAGGG + Intronic
950876879 3:16283640-16283662 AGTTGTCAGCAGAAGGTGGGAGG + Intronic
951432884 3:22628420-22628442 ATTTGCAAACTCTAGGTGGAGGG - Intergenic
951946090 3:28137997-28138019 TTTTGCAAACTGAAGGTGGTTGG + Intergenic
952134232 3:30399015-30399037 GTTTGCAAGCAGAAGTAGAAAGG - Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952465151 3:33576503-33576525 ATTTACAACCACAAGGTAGAAGG + Intronic
952581459 3:34838255-34838277 ATTTCCAAGCAAAGAGTGGAAGG - Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
953577759 3:44126978-44127000 ACCTGCCATCAGAAGGTGGATGG + Intergenic
956151509 3:66248231-66248253 AATTGCAAACATAAGGTAGAAGG - Intronic
956540446 3:70332405-70332427 ACTTGCAACCAGAATGAGGATGG - Intergenic
956915522 3:73867159-73867181 TTTTGCAAGCATAATGTGGTAGG - Intergenic
957202609 3:77156168-77156190 ATTTGAAAGGAGAAGGAGAATGG - Intronic
957240914 3:77660277-77660299 ATTTCCAAGCAGAGTGTTGAAGG - Intergenic
957540816 3:81566661-81566683 ATTTGAGAGCAAAAGGAGGAAGG - Intronic
958875118 3:99607453-99607475 ATTTGCAACAAGAATGTGTATGG + Intergenic
959291781 3:104484583-104484605 ATTTGGAAGGAGTAAGTGGATGG + Intergenic
961181337 3:124880504-124880526 ATTTGCAAGGACCAGGTGGGAGG + Intronic
961745598 3:129061897-129061919 GTTGGCCAGCAGAAGGTGGCGGG - Exonic
962571464 3:136717579-136717601 ACTTGCACCCAGGAGGTGGAGGG + Intronic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
963392007 3:144676700-144676722 ATTTGCATGCAGAATCTAGAGGG + Intergenic
963622404 3:147627629-147627651 TTTTGCAAGCAGAAAGTTGGAGG + Intergenic
963982500 3:151555338-151555360 CTTTGCAAGCAGAATTTAGAGGG + Intergenic
964507472 3:157415262-157415284 ATTTGCAAGCTGTAGGTGATGGG + Intronic
964724035 3:159795722-159795744 ATTTGCCAGGAGGATGTGGAAGG + Intronic
965034361 3:163417989-163418011 AGTTGCAATCAGAAAATGGAGGG + Intergenic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966903386 3:184503802-184503824 TGATGCAGGCAGAAGGTGGAAGG + Intronic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
968705656 4:2076212-2076234 AAGTGCAAGCACAAGGCGGACGG + Intronic
969576320 4:8038140-8038162 TTTTGCGAGCAGATGATGGAGGG - Intronic
969907787 4:10413460-10413482 ATATGACAGCAGAACGTGGAGGG - Intergenic
970696477 4:18684273-18684295 ATTTGAGAGCAGATTGTGGATGG + Intergenic
971930106 4:33070401-33070423 ATTTTCAAGCAAAGTGTGGAAGG + Intergenic
974269731 4:59634416-59634438 AATTGGAGGCAGAAGGTGAAAGG + Intergenic
974602162 4:64097410-64097432 ATTTGCATGCAGAAAGTTTATGG - Intergenic
975579048 4:75890699-75890721 ATTTGCAAGCAGAAGGAAAGGGG + Intronic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978818979 4:112943360-112943382 ATTTGCAAGCAGTAGAAAGAAGG - Intronic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
980005192 4:127533627-127533649 ATTTGAACCCAGAAGGTGCAGGG - Intergenic
980197584 4:129610678-129610700 ATTTGCATGCAGTAGTTGTAAGG - Intergenic
981062607 4:140441666-140441688 ATTTGCAAGCAGCAGGGGTGAGG + Intergenic
981693826 4:147539131-147539153 GTTTGCAAGCAGAAGGATGAGGG - Intronic
981778256 4:148394962-148394984 GTTTGCAAGCAGAATGTAGTGGG + Intronic
982407252 4:155034226-155034248 ATTTGGGAGCCCAAGGTGGAAGG - Intergenic
982710556 4:158754591-158754613 ATTTGGAAGCAGATGGTCTATGG - Intergenic
983968718 4:173845116-173845138 ATTTCCAGGCAGAATGTTGAGGG + Intergenic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
985822375 5:2169071-2169093 AATTGCAAGGAGTAGGTGGAGGG - Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
990353572 5:54942266-54942288 AATTGCAAGCAGCAGGAGGTGGG - Intergenic
990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG + Intergenic
991970130 5:72132942-72132964 ATTTGCCAGCAGAGGGTTGTAGG + Intronic
993803974 5:92381077-92381099 ATCTCCAAGCAGAATATGGAAGG - Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
996010529 5:118477562-118477584 CCTTGCAAGCCCAAGGTGGATGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
999756046 5:154665239-154665261 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1000075496 5:157781224-157781246 ATTCGCAGGCTAAAGGTGGATGG - Intergenic
1001322450 5:170693804-170693826 ATTAGCAAGAAGAAAGTGGAGGG + Intronic
1002921640 6:1577261-1577283 ATTTGCTAGCAGAAGCTGGAGGG - Intergenic
1003823651 6:9928090-9928112 AGTTCCAAGGTGAAGGTGGAAGG - Intronic
1003828741 6:9981442-9981464 GTTTGCAAGCAACAGGTGCAGGG + Intronic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1003965918 6:11251974-11251996 AAGTGCAAGCAGAAGGTGAGGGG - Intronic
1004138037 6:12987785-12987807 ATTTGCTAGAATAAGATGGAAGG + Intronic
1004535496 6:16496896-16496918 ATCTGCAAGATGAAGGAGGAGGG - Intronic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1007967258 6:46014707-46014729 ATTTGCAACCTGTAGGAGGAAGG - Intronic
1008447008 6:51604043-51604065 ATTTGCCTACAGTAGGTGGAGGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1013731646 6:113175276-113175298 ATTTGCAGGAAGAAGCTTGAAGG + Intergenic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014457239 6:121650066-121650088 AATTGAAAGCAGAAAGTAGATGG + Intergenic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1015327876 6:131944761-131944783 ATTTGAAAGCACAAGTTGAAAGG - Intergenic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1017984526 6:159432064-159432086 ATTTGCAGTCAGATGGTGGTTGG + Intergenic
1018387699 6:163319832-163319854 TTTTGCAAGCAAAAGCTGGGAGG + Intergenic
1018435599 6:163755662-163755684 ATTTGGGAGCAGAACGTTGAAGG - Intergenic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1019389789 7:779600-779622 ATCTGGGAGCAGGAGGTGGAGGG + Intronic
1020490049 7:8770826-8770848 ATTGGAAAGCAGAAGGTTGTTGG + Intergenic
1020746348 7:12083337-12083359 ATTCGCAAGCAAAAGGTAAAGGG + Intergenic
1022326237 7:29334509-29334531 ATTTGGAAGCCCAAGGTGGGTGG + Intronic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1022805675 7:33819863-33819885 ATTTCCAAGCAAAGTGTGGAAGG - Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024415637 7:49102800-49102822 ATTCTCAAGCAGAAAGTAGAGGG - Intergenic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1027945489 7:84739702-84739724 AAGTGCTAGCAGAAGGTGGCAGG + Intergenic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1029503526 7:100948811-100948833 GCTTGAAACCAGAAGGTGGAGGG - Intergenic
1029794248 7:102876731-102876753 TTTAGCAAGCAGATGGAGGAGGG + Intronic
1029877675 7:103771224-103771246 TTTTACAAGCAGAAGGTGATTGG - Intronic
1030581373 7:111359834-111359856 AAATGCAAGAAGTAGGTGGAGGG + Intronic
1031007751 7:116493733-116493755 ATTTGCAAGATCCAGGTGGAAGG + Intronic
1031695097 7:124841679-124841701 ATTTGGAATCAAAAGGTGTATGG + Intronic
1032145873 7:129380114-129380136 ATTTGCAAGTACCAGATGGAGGG - Intronic
1034090264 7:148357473-148357495 ATTTGCAAAGAGAAGGCTGATGG - Intronic
1034097117 7:148419685-148419707 ATTTGCAAGGCCGAGGTGGACGG - Exonic
1036044095 8:5120310-5120332 AATTCCAAACAGAAAGTGGAGGG + Intergenic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1039541954 8:38380613-38380635 GTTTGCAACCAGAAGGAAGAGGG + Intronic
1039677534 8:39685788-39685810 ATATGTTAGCAGATGGTGGAGGG - Intronic
1041223162 8:55671690-55671712 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1041458622 8:58087010-58087032 ATCTGCAACCAGACGGTGTATGG - Intronic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1042021321 8:64373299-64373321 AATTTCAAGCAGAAAGTAGAAGG + Intergenic
1042069706 8:64917763-64917785 ATTTGCAAGGAGAAGGAGAAAGG - Intergenic
1042921819 8:73927666-73927688 ACTTGAAACCAGGAGGTGGATGG - Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043990017 8:86741418-86741440 CTTTGCAAGGACAAGGTGGGCGG + Intronic
1044737723 8:95296366-95296388 ACTTGCAGGGAAAAGGTGGAAGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1047130953 8:122018787-122018809 TTTTGCAGGCAGGAGGTGGTGGG + Intergenic
1047487928 8:125349503-125349525 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1049400647 8:142425456-142425478 ACATGCAAGCAGATGGTGGATGG - Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049691519 8:143962778-143962800 ATTTCCAAGCAAAGTGTGGAAGG + Intronic
1050525011 9:6538715-6538737 ATTTGCAAGGAGAGAGAGGAGGG - Intronic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1052683242 9:31721367-31721389 ACTTGAACCCAGAAGGTGGAGGG + Intergenic
1053034385 9:34811490-34811512 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1053113697 9:35483602-35483624 ATTAGCAAGCTGAAGGAGGGAGG + Intergenic
1053463034 9:38285256-38285278 ATTTGCAGGCAAAAAGTGGCAGG + Intergenic
1055243078 9:74207717-74207739 ATTTGCAAGCTGAAGGGGAGGGG - Intergenic
1055809220 9:80132521-80132543 AGTTGCAACCAAAATGTGGAAGG + Intergenic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1057748564 9:97771842-97771864 ATTTACAAGCAGGAGGTTGAAGG + Intergenic
1057890308 9:98864888-98864910 CTTTGCAACCAGAAGCTGAAGGG + Intergenic
1058795835 9:108497678-108497700 ATGTGCAAGCAGAGGGTAGTAGG - Intergenic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187093816 X:16125771-16125793 ATGTGCAAGCCGAAGGGGAATGG - Intronic
1187203629 X:17160155-17160177 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
1188440822 X:30214292-30214314 ATTTGCAAGGAGATCATGGAGGG + Intergenic
1188598513 X:31931264-31931286 GTTGTCAAGCAGAAGGTGAAAGG - Intronic
1188659420 X:32740096-32740118 ATTTCCAAGCAGAAGCTTTACGG + Intronic
1188880408 X:35485314-35485336 ATTGGCAAGTGGAAGGTGAATGG + Intergenic
1189100025 X:38179328-38179350 ATTTGCAAGCTGGAGCTGAATGG + Intronic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190737723 X:53266798-53266820 AATTCCAAGAAGAAGGTGGGGGG + Intronic
1192868704 X:75164257-75164279 GTTGGAAAGCAGAAGGTGAAAGG - Intergenic
1194146139 X:90266592-90266614 ATTTGCAAGACCAAGGAGGATGG - Intergenic
1194170526 X:90575189-90575211 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1194755385 X:97733075-97733097 ATTTTCAGGCAGAATGTTGAGGG + Intergenic
1194762368 X:97809954-97809976 ATTTGAACCCAGGAGGTGGATGG - Intergenic
1196164016 X:112518527-112518549 ACTTACAACCAGAAGGTGAAGGG + Intergenic
1198672024 X:139091326-139091348 CTCTGCAAGCAGAGGGTGGGAGG + Intronic
1198700119 X:139387788-139387810 ATTTGCAGGCTGAAGATTGATGG + Intergenic
1200516769 Y:4152949-4152971 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1201908226 Y:19106545-19106567 ATTTGCTTGAGGAAGGTGGAAGG + Intergenic