ID: 977917806

View in Genome Browser
Species Human (GRCh38)
Location 4:102613402-102613424
Sequence CTGTGAGAAAGAAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1458
Summary {0: 1, 1: 0, 2: 11, 3: 116, 4: 1330}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977917806_977917817 26 Left 977917806 4:102613402-102613424 CCTCCTTCCTTTCTTTCTCACAG 0: 1
1: 0
2: 11
3: 116
4: 1330
Right 977917817 4:102613451-102613473 GGTGGAGGCCCTGAGACAAATGG 0: 1
1: 0
2: 0
3: 22
4: 221
977917806_977917818 27 Left 977917806 4:102613402-102613424 CCTCCTTCCTTTCTTTCTCACAG 0: 1
1: 0
2: 11
3: 116
4: 1330
Right 977917818 4:102613452-102613474 GTGGAGGCCCTGAGACAAATGGG 0: 1
1: 0
2: 0
3: 18
4: 129
977917806_977917815 8 Left 977917806 4:102613402-102613424 CCTCCTTCCTTTCTTTCTCACAG 0: 1
1: 0
2: 11
3: 116
4: 1330
Right 977917815 4:102613433-102613455 GGGTACAGTCAGAGAGCTGGTGG 0: 1
1: 0
2: 1
3: 33
4: 270
977917806_977917814 5 Left 977917806 4:102613402-102613424 CCTCCTTCCTTTCTTTCTCACAG 0: 1
1: 0
2: 11
3: 116
4: 1330
Right 977917814 4:102613430-102613452 TGGGGGTACAGTCAGAGAGCTGG 0: 1
1: 1
2: 1
3: 15
4: 194
977917806_977917816 11 Left 977917806 4:102613402-102613424 CCTCCTTCCTTTCTTTCTCACAG 0: 1
1: 0
2: 11
3: 116
4: 1330
Right 977917816 4:102613436-102613458 TACAGTCAGAGAGCTGGTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977917806 Original CRISPR CTGTGAGAAAGAAAGGAAGG AGG (reversed) Intronic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900320759 1:2082534-2082556 CTGTGAGGAAGGAACGATGGTGG + Intronic
900502518 1:3013320-3013342 CAGAGAGACAGAAAGGAAGAGGG - Intergenic
900634962 1:3658439-3658461 CTCTGTGACAGAAAGGAAAGGGG + Intronic
901499015 1:9640040-9640062 ATGAAAGAAAGAAAGAAAGGAGG - Intergenic
901524342 1:9810074-9810096 GAGAGAGAGAGAAAGGAAGGAGG + Intronic
901956583 1:12790047-12790069 ATGTGAGAGAGAAATGAACGAGG - Intergenic
901979965 1:13026191-13026213 ATGTGAGAGAGAAATGAACGAGG - Intronic
902002122 1:13202740-13202762 ATGTGAGAGAGAAATGAACGAGG + Intergenic
902021349 1:13348480-13348502 ATGTGAGAGAGAAATGAACGAGG + Intergenic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902097349 1:13957660-13957682 GGGTGAGAGAGAAAGCAAGGTGG + Intergenic
902388596 1:16089844-16089866 AGGAAAGAAAGAAAGGAAGGAGG + Intergenic
902673104 1:17988963-17988985 CTTTGAGAAACCAAGGCAGGAGG + Intergenic
902765394 1:18611211-18611233 GAGAGAGAAAGAAAGGAGGGAGG + Intergenic
902989320 1:20175156-20175178 CGATGAGAAAAAAAGGAAGAAGG + Exonic
903051141 1:20602114-20602136 CTGTCAAAAAGAAAGGAGAGGGG + Intronic
903102274 1:21041174-21041196 CTGAGAGAAAGTCAGGAAAGGGG - Intronic
903215241 1:21840018-21840040 CTGGGAGAAAGCAAGGAGGCTGG + Intronic
903252977 1:22070029-22070051 CTTTGAGAAGCCAAGGAAGGTGG - Intronic
903311400 1:22460118-22460140 GAGTGAGAAAGAGATGAAGGTGG - Intronic
904285964 1:29453476-29453498 TAGTGAGACAGAAAGGAGGGAGG + Intergenic
904495133 1:30882307-30882329 CTGTGAGGAAAAATGGAAGCAGG - Intronic
905008713 1:34732017-34732039 CTGTGAGATGGAGAGGGAGGAGG + Intronic
905024296 1:34839222-34839244 GAGAGAGAAAGAAAGGAGGGAGG + Intronic
905254264 1:36669988-36670010 CCGTGAGAAACAAAGGCAGGGGG - Intergenic
905299342 1:36975865-36975887 CTGGGATACAGAAAGGAATGGGG - Intronic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905805689 1:40875555-40875577 GAGAGAGAGAGAAAGGAAGGAGG - Intergenic
905837712 1:41142591-41142613 CTGAGAGAGAGAATGGAAGGAGG - Intronic
906299416 1:44671184-44671206 CTGGGAAAAAGAGAGGGAGGAGG + Intronic
906642806 1:47451506-47451528 CAGTGAAAAAGAAAGAGAGGGGG - Intergenic
906990553 1:50732849-50732871 CTAGAAGAAAGAAAGGAATGAGG - Intronic
907273434 1:53304053-53304075 GTGGGAAAAAGAAAGGAAAGGGG + Intronic
907317340 1:53580752-53580774 GTGTGAGGAAGGAAGGAAAGCGG - Intronic
907336082 1:53700448-53700470 CTGTCAGGAAGGAAGGATGGAGG + Intronic
907535662 1:55153465-55153487 ATGAGAGAGAGAAAGGAAGGAGG - Intronic
907861597 1:58358915-58358937 GAGAGAGAAAGAAAGGAAGGGGG - Intronic
908187435 1:61665949-61665971 CTGTGAAGAAGAAAAGAAGTTGG + Intergenic
908359685 1:63356916-63356938 GTGTGTGAAAGAAAGGGAGAGGG - Intergenic
908705678 1:66951778-66951800 CTGTGAGAAATAAGGAAAGTGGG - Intronic
908797188 1:67842332-67842354 CTATGAGCAGGAAAGGAATGGGG - Intergenic
908902843 1:68976101-68976123 CAGAGAGAAAGAAAGAGAGGAGG - Intergenic
909483081 1:76146505-76146527 GTGTGAGGGAGAAAAGAAGGAGG - Intronic
909487093 1:76186432-76186454 CTATGAGAATGGAATGAAGGAGG - Intronic
909521237 1:76570365-76570387 CTAAGAGAAAGAAAGGAAAGAGG - Intronic
909701121 1:78524552-78524574 CAGTGAGAAAGAAAGCATGCAGG - Intronic
909811306 1:79934390-79934412 GAGAGAGAAAGAAAGAAAGGAGG - Intergenic
909815544 1:79988336-79988358 CTATGGGAAATACAGGAAGGTGG - Intergenic
910059167 1:83068133-83068155 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
910866738 1:91795351-91795373 CAGTGAGGAAGAAAAGAAAGAGG - Intronic
911090619 1:94014298-94014320 CAATGAAAAAGGAAGGAAGGAGG + Intronic
911135493 1:94435024-94435046 CTGTAAGAAAGAAAGGGAAAGGG - Intronic
911222111 1:95259553-95259575 CTAAGAAAAGGAAAGGAAGGAGG - Intergenic
911417876 1:97598590-97598612 CTCTGAAAAAGAAGGGAGGGAGG + Intronic
911460759 1:98187188-98187210 CTGGAAGAAAGAAAAAAAGGTGG - Intergenic
912219117 1:107651672-107651694 CTGGGAGGTAGAAATGAAGGTGG - Intronic
912800352 1:112715954-112715976 TTCTGAGAGAGAAAGGAGGGTGG - Intergenic
912854397 1:113154218-113154240 CTGTAGGAGGGAAAGGAAGGAGG + Intergenic
912864620 1:113246193-113246215 TTGAGAGCAAGATAGGAAGGGGG - Intergenic
913298750 1:117347886-117347908 ATGCAAGAAAGGAAGGAAGGAGG - Intergenic
914247595 1:145897469-145897491 GTGGGAGAAGGAAAGAAAGGAGG - Intronic
914462614 1:147898828-147898850 CTCTGAGAAACATAGGACGGGGG - Intergenic
914872546 1:151487291-151487313 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
914920630 1:151844944-151844966 CTCTGAGACTGAAAGGAAGGAGG - Intergenic
915393178 1:155562535-155562557 CGGTGGGAAAGAACGCAAGGAGG - Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915484845 1:156213051-156213073 CTGTGAGGAAAAAAGGCATGAGG + Exonic
915566325 1:156715379-156715401 TTCTGGGAAAGAAAGGAAAGAGG - Intergenic
915596507 1:156899470-156899492 CTGACAGAGAGAAAGGAAGTGGG - Intronic
915949670 1:160180646-160180668 AGGTCAGAAAGAAAGGATGGTGG - Intronic
916231854 1:162548619-162548641 AGGAGAGAAAGAAGGGAAGGAGG - Intergenic
916232205 1:162551484-162551506 AGGAGAGAAAGAAGGGAAGGCGG - Intergenic
916446943 1:164881282-164881304 CAGAGAGAAAGGAAGGAAAGAGG + Intronic
917349195 1:174059021-174059043 TTGTGAGAAAGTCAGTAAGGGGG - Intergenic
917433374 1:174994796-174994818 GAGTTAGAAAGAAAGGAAGTGGG - Intronic
917448327 1:175125674-175125696 AAGAGAGAAAGAAAGGAGGGAGG - Intronic
917485438 1:175450922-175450944 GTGTGAGAAAAAAAGAATGGTGG - Intronic
917509132 1:175655787-175655809 CTGTGAGGGAGAAAGGAACAGGG + Intronic
918005681 1:180540220-180540242 AAGAAAGAAAGAAAGGAAGGAGG + Intergenic
918473380 1:184898130-184898152 CTGTGAGCAAGGGAGGAGGGAGG - Intronic
918511596 1:185318579-185318601 CTGTGAGAAAAAAAGGGGCGGGG - Intergenic
918869207 1:189946337-189946359 GTGTGAGAGAGAAAGAAAGAGGG - Intergenic
919257544 1:195142965-195142987 CTGTCAGAAAGAAAGAAGGAAGG + Intergenic
920167255 1:204044677-204044699 GAGGGAGAAAGGAAGGAAGGAGG + Intergenic
920181157 1:204132283-204132305 GTGTGAGGAAGAAAGCCAGGTGG + Intronic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
922218097 1:223537145-223537167 CTTTGAGAAGCCAAGGAAGGAGG + Intergenic
922764076 1:228148638-228148660 CAGTGAGGAAGAAAGGGAGTTGG - Intronic
923480647 1:234379986-234380008 CTGTAACAAAGAAGGGAAGCAGG + Intronic
923539072 1:234875497-234875519 AGCTGAGAATGAAAGGAAGGTGG + Intergenic
923543038 1:234903169-234903191 CTTCCAGAAACAAAGGAAGGGGG - Intergenic
923696905 1:236262344-236262366 GTGTGAGAAAGCAAGCAATGTGG - Intronic
923731113 1:236551169-236551191 CTGTGGGCAAGGAATGAAGGCGG - Exonic
923958313 1:239047732-239047754 TTGTGAGAAAGAAAGCAAATTGG + Intergenic
924247699 1:242100783-242100805 CTGTAAGAAAAAAAAAAAGGGGG + Intronic
924480397 1:244426684-244426706 ATGTGAGAAAGCAAGCAAAGTGG - Intronic
924508484 1:244709153-244709175 GTGAGAGGAAGAAAGGATGGAGG - Intergenic
924773874 1:247101278-247101300 CTGTGTGAAAGTAAAGAAGATGG - Exonic
1062906552 10:1183467-1183489 GTGGGAGAAAGAAAGGCAGAAGG - Intronic
1063152460 10:3349611-3349633 CTGGAAGAAAAAAAGGAATGCGG + Intergenic
1063212090 10:3890077-3890099 CTGTGACAAAAAAAGGATTGAGG - Intergenic
1063344418 10:5297857-5297879 GCCTGACAAAGAAAGGAAGGGGG + Intergenic
1063665970 10:8060890-8060912 CTGTGAGAAAGGAATTAAGAAGG - Intronic
1063691895 10:8295607-8295629 GAGAGAGGAAGAAAGGAAGGAGG - Intergenic
1063722919 10:8602382-8602404 CTGTGAGATAGAATGGGAAGGGG + Intergenic
1063759093 10:9051871-9051893 CTGTGAGAGAGAAAGCCATGGGG - Intergenic
1063783569 10:9354227-9354249 CTTTGGGAAATCAAGGAAGGTGG + Intergenic
1063791758 10:9457229-9457251 GTTTGAGAAAGAAAGGCAGGAGG - Intergenic
1063825300 10:9890724-9890746 CTGTGAGAGAAAAAGGAGAGAGG - Intergenic
1063862606 10:10327918-10327940 CTTTGAGAAAGGATAGAAGGAGG + Intergenic
1063906162 10:10782376-10782398 CAGTGAGGCAGAAAGAAAGGGGG + Intergenic
1063937920 10:11098093-11098115 ATGTGAGAAAGAAAGTCACGTGG + Intronic
1064088107 10:12360857-12360879 CCGGGAGAAAGAAAGAAAGATGG - Intronic
1064131458 10:12713601-12713623 CAGGGAGAAAGGAAGAAAGGAGG + Intronic
1064315683 10:14253907-14253929 CTGTGAGAGAGAGAGAAAGCTGG - Intronic
1064340518 10:14481429-14481451 TTGTGAGGAAGGAAGGAAGGAGG - Intergenic
1064418843 10:15172989-15173011 CTTTCAGGAAGAAAGGATGGAGG + Intergenic
1064631817 10:17322257-17322279 AAGAGAGAAAGAAAAGAAGGAGG + Intronic
1064651620 10:17515541-17515563 CTGTGAGAAATAAATGTTGGTGG - Intergenic
1064652080 10:17519588-17519610 GAGGGAGAAAGAGAGGAAGGAGG + Intergenic
1064813278 10:19226620-19226642 CAGGGAGAAAGAAAGAAGGGAGG + Intronic
1064934456 10:20664351-20664373 GAGTGAGAGAGAAGGGAAGGAGG - Intergenic
1065001781 10:21343819-21343841 AAGTGAGAAAGAAAGAAAGAAGG + Intergenic
1065099591 10:22320802-22320824 CCGGGAGAAAGAAAGAACGGGGG + Intronic
1065334816 10:24645876-24645898 GAGTGAGAAGGAAAGGAAGAGGG + Intronic
1065360040 10:24880993-24881015 AAGAGAGAAAGGAAGGAAGGAGG - Intronic
1065497279 10:26342089-26342111 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1065531621 10:26675877-26675899 GAGAGAGAAAGAAGGGAAGGAGG + Intergenic
1065583360 10:27193732-27193754 ATGGGAGAAAGAAAGACAGGAGG + Intergenic
1065639811 10:27770330-27770352 GAAAGAGAAAGAAAGGAAGGAGG - Intergenic
1065660203 10:27998638-27998660 CTGGGAGAGAGAAGGGAAGGGGG + Intronic
1065769473 10:29064018-29064040 CTGTTAGCAAGAAAGAAATGGGG + Intergenic
1065810298 10:29436965-29436987 CTTTGAGAAAAAAAGGGGGGGGG - Intergenic
1066055882 10:31679467-31679489 ATGAGAGAAAGAAAGAAAAGAGG - Intergenic
1066383584 10:34922183-34922205 AAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1066584896 10:36922000-36922022 CAGGGAGAAAGAAGGGAAGATGG - Intergenic
1066779777 10:38931715-38931737 GAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1066818860 10:39456774-39456796 AAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1067295151 10:44971432-44971454 CTGTGAGGAAGCAACGCAGGTGG + Intronic
1067321688 10:45226870-45226892 CTTTGAGAGAGAAATGCAGGAGG - Intergenic
1068041822 10:51834642-51834664 CTGTCAAAAAGAAAGAAAGAAGG + Intronic
1068061089 10:52068377-52068399 TTAGGGGAAAGAAAGGAAGGTGG - Intronic
1068201429 10:53788634-53788656 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1068258527 10:54545548-54545570 AGGAGAGAAAGCAAGGAAGGAGG + Intronic
1068800973 10:61139412-61139434 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1069096504 10:64265770-64265792 ATAAGAGTAAGAAAGGAAGGGGG - Intergenic
1069213880 10:65795600-65795622 GTGTGAGAAAGGTAAGAAGGAGG + Intergenic
1069480619 10:68778394-68778416 ATATGAGAAACTAAGGAAGGTGG - Intronic
1070256390 10:74816256-74816278 TTGTGATGAAGAAAGGATGGAGG - Intergenic
1070338526 10:75475967-75475989 ATGTGGGAAAGAAGGGAGGGCGG - Intronic
1070732689 10:78842226-78842248 CTCTGAGCAGGAGAGGAAGGGGG + Intergenic
1071232986 10:83610838-83610860 CTGGGAGACAGAAAGCAAGCAGG + Intergenic
1071444866 10:85736169-85736191 CAGGAAGAAAGGAAGGAAGGAGG + Intronic
1072827278 10:98619876-98619898 ATGTGAGGAAGAAAGGCAGGTGG + Intronic
1072914167 10:99526998-99527020 AGGTGAGGAAGAAAGGAAGTGGG + Intergenic
1073053968 10:100687303-100687325 CTGTGTGCAAGAGAGGGAGGGGG - Intergenic
1073546707 10:104355019-104355041 GTATGATAAGGAAAGGAAGGAGG - Intronic
1073553846 10:104428776-104428798 ATGTGAGATGGACAGGAAGGCGG + Intronic
1073559090 10:104481742-104481764 CTAAGACAAGGAAAGGAAGGAGG - Intergenic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074161987 10:110843095-110843117 CTGAGGGCAAGAGAGGAAGGAGG + Intergenic
1074270169 10:111945524-111945546 CTGTGAAATAGCAAGGATGGCGG - Intergenic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074589292 10:114797580-114797602 CTGCAGGAAAGACAGGAAGGTGG - Intergenic
1074816561 10:117145958-117145980 GAGAGAGAGAGAAAGGAAGGAGG + Intergenic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1075153231 10:119953684-119953706 AAGGAAGAAAGAAAGGAAGGAGG - Intergenic
1075301723 10:121330672-121330694 GTGTGAGAGAGAGAAGAAGGAGG - Intergenic
1075936853 10:126350426-126350448 CTTTGAGAAAGGGAGGAAGAGGG + Intronic
1076222261 10:128743857-128743879 CTGTGATAAACAAAGCAAGTGGG + Intergenic
1076325146 10:129615353-129615375 CAGTGAGAAGGAAAAGAACGAGG - Intronic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077955381 11:7013653-7013675 CAGTGAGAGAGAAAAGGAGGTGG - Intronic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078200607 11:9179383-9179405 CAGGGAGAAAGGAAGGAATGTGG + Intronic
1078204863 11:9219943-9219965 CATTTAGAAAGAAAGGAAAGGGG + Intronic
1078598419 11:12709770-12709792 CTGTGTGAAACCAAGGCAGGAGG - Intronic
1079137690 11:17785189-17785211 GTGTGAGAAGGAAGGGAAAGAGG - Intergenic
1079249221 11:18774879-18774901 ATCTGAGAGAGAAAGGAAGCAGG + Intronic
1079960632 11:26919036-26919058 TTGTGAAAAAGAAATGAAGGAGG + Intergenic
1080060211 11:27948975-27948997 CTGCGAGAAAGGATGGAGGGAGG - Intergenic
1080237077 11:30082924-30082946 ATGGAAGAAAGAAAGAAAGGAGG + Intergenic
1080416412 11:32073413-32073435 GTGGCAGAATGAAAGGAAGGGGG - Intronic
1080532226 11:33188192-33188214 TTCAGAGATAGAAAGGAAGGGGG - Intergenic
1080543799 11:33296073-33296095 CTGAAAGAAAGGAAGGGAGGGGG - Intronic
1080715443 11:34795839-34795861 CAGGAAGACAGAAAGGAAGGAGG + Intergenic
1080879651 11:36307631-36307653 CTTTCAGAAGGAAAGGAAAGGGG - Intronic
1081117293 11:39219252-39219274 AAGTAAGAAAGAAAGAAAGGAGG + Intergenic
1081726579 11:45333971-45333993 CTGTTAGCATGAAAGAAAGGGGG + Intergenic
1081838456 11:46177045-46177067 CTGTGAGAAGGAAAGGAGACTGG - Intergenic
1082171675 11:49012460-49012482 AGGTGAAAAAGAGAGGAAGGAGG - Intergenic
1083040993 11:59687373-59687395 ATGAAAGAAAGAAAGGAAAGAGG + Intergenic
1083160370 11:60850568-60850590 CTTGGAGAAGGAGAGGAAGGAGG - Exonic
1083417793 11:62536516-62536538 CTGAGGGGAAGAGAGGAAGGAGG - Exonic
1083577248 11:63801082-63801104 GGGAGAGAAAGAAAGGAGGGAGG + Intergenic
1083730671 11:64650819-64650841 CGGGGAGAATGTAAGGAAGGAGG + Intronic
1083767422 11:64848481-64848503 TGGTGAGAAGGAAAGGAAAGAGG - Intergenic
1083826124 11:65205050-65205072 CTGGCCGAAAGAGAGGAAGGGGG + Intronic
1084323934 11:68388328-68388350 CTGTGAAAAAGGAAGGGATGGGG + Intronic
1084715873 11:70873008-70873030 CTGTGAGAAAGGAAGAGCGGAGG + Intronic
1084937446 11:72594704-72594726 ATGTGAGCAAGGCAGGAAGGAGG - Intronic
1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG + Intergenic
1085031052 11:73271105-73271127 CTGTAAGAAAGAAGAGGAGGAGG + Intronic
1085152354 11:74262391-74262413 CAGAGAGAAAGAAGGGAAAGAGG + Intronic
1085383066 11:76138316-76138338 CTGTGAGGAAGATAGGCAGGTGG - Intronic
1085401717 11:76239657-76239679 CTGGGAGATAGAGAAGAAGGTGG - Intergenic
1085446988 11:76607567-76607589 GGGTGAGAGAGAAAGGAAGGGGG - Intergenic
1085667672 11:78429835-78429857 CTGTAAGGCAGATAGGAAGGAGG + Intergenic
1085778094 11:79383998-79384020 CCATGGGGAAGAAAGGAAGGGGG - Intronic
1086143624 11:83526361-83526383 CTGTGGGAAGGAAAGGTTGGAGG - Intronic
1086249686 11:84798401-84798423 CTGTGGAAAAGAGAGGAAAGAGG - Intronic
1086561804 11:88177007-88177029 CTGTGTGAAAGGGAGAAAGGAGG + Intergenic
1086615919 11:88819871-88819893 GTGCGAGAGAGAAAGGAAAGGGG + Intronic
1086775609 11:90828931-90828953 CTTGGAGAAAGAAATAAAGGAGG - Intergenic
1086815597 11:91366776-91366798 CAGTGACAGAGAAAGGAATGTGG - Intergenic
1086878148 11:92122498-92122520 CTGGAGGAAAGAAAAGAAGGAGG + Intergenic
1086956265 11:92937245-92937267 CTTGGAGAAAGCAAGGGAGGAGG + Intergenic
1087152626 11:94872379-94872401 CTTAGAGGAAGAAAGAAAGGGGG + Exonic
1087762042 11:102111438-102111460 CGGGAAGAAAGAAAGGAAGAAGG - Intronic
1087826562 11:102771137-102771159 CTGTAAGGAAGGAAGGAGGGAGG + Intronic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1088547834 11:110979493-110979515 CTGTGAGCAAGAAAGGAGGAAGG - Intergenic
1088575176 11:111264727-111264749 GAAAGAGAAAGAAAGGAAGGAGG + Intronic
1088598761 11:111457822-111457844 CTGGAAGAAAGAAACCAAGGGGG - Intronic
1088616532 11:111635394-111635416 AAGGGAGAAAGGAAGGAAGGAGG + Intronic
1089068189 11:115678219-115678241 GAGAGAGAAAGAAAAGAAGGAGG + Intergenic
1089201316 11:116726202-116726224 TCCTGAGAAAGAAAGGAAAGGGG - Intergenic
1089211232 11:116804504-116804526 CTTTGAGAAGGCAAGGCAGGAGG + Intergenic
1089572760 11:119421102-119421124 CTCAGGGAAAGCAAGGAAGGAGG + Intronic
1090027359 11:123179398-123179420 GTGTCAGAAAGAAAGGAACAAGG + Intronic
1090040205 11:123283988-123284010 GAGAGAGAAAGAAAGGAAAGCGG - Intergenic
1090561156 11:127934247-127934269 GAGAGAGAAAGAAAGGAGGGAGG - Intergenic
1090600290 11:128362903-128362925 CTGGGTGACAGAAAGTAAGGGGG - Intergenic
1091214017 11:133889085-133889107 CAGAGACAAAGAAAGGATGGAGG + Intergenic
1091317290 11:134623559-134623581 CTTGGAGAAAGAACAGAAGGAGG + Intergenic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1091941229 12:4484489-4484511 CAGACAGGAAGAAAGGAAGGAGG + Intergenic
1091976152 12:4827244-4827266 GCGAGAGAAAGGAAGGAAGGAGG - Intronic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092068100 12:5609209-5609231 CTGTCAGAAAGCAGGGAACGGGG + Intronic
1092268133 12:6999391-6999413 CTGTGAGAAAGAAAGAAAAAGGG + Intronic
1092389769 12:8065837-8065859 CTGTGATAGAGAAAGAAAAGTGG + Intronic
1092461167 12:8687622-8687644 CAGAAAGGAAGAAAGGAAGGAGG - Intronic
1092579041 12:9819683-9819705 CTGTAAGACAGCAAGGATGGTGG - Intergenic
1092792386 12:12081203-12081225 CTGTGGGAAACCAAGGCAGGAGG + Intronic
1093534709 12:20209755-20209777 CTGTAAGAAGGAAGGGAATGAGG + Intergenic
1093553508 12:20443969-20443991 ATGAGAGAAGGAAAAGAAGGAGG + Intronic
1093864056 12:24203592-24203614 CTCTGTCAAAGAAAGGAAGAGGG - Intergenic
1094615070 12:32029216-32029238 CTGTAGGAAAGAAAAGAAGGAGG + Intergenic
1095181592 12:39153369-39153391 CTGGGAGAAAGTAAGGGAAGAGG - Intergenic
1095297359 12:40542251-40542273 CTGTGAGATAGAAAGGAGGGGGG - Intronic
1095349830 12:41196210-41196232 CTGTAAGATAAAAAGTAAGGAGG + Intronic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1095742622 12:45623477-45623499 CTGTGGGATACATAGGAAGGAGG + Intergenic
1095865854 12:46971541-46971563 CTGAGAGACAGAAGGGTAGGAGG - Intergenic
1095914283 12:47460426-47460448 CTGTGATAAAGAAAGGATATAGG + Intergenic
1095999391 12:48116165-48116187 GGGAGAGGAAGAAAGGAAGGAGG - Intronic
1096480073 12:51934247-51934269 ATGTGAGCAAGAAGGGGAGGAGG - Intergenic
1096519231 12:52174779-52174801 CTGTGAGCAGGAAAGAAAGCTGG - Intronic
1096791030 12:54045080-54045102 CTCTGAGAAAGAAATGAGGGTGG - Intronic
1096844925 12:54401263-54401285 CTGAGAGAAAGAGAGGAGGGAGG - Intronic
1096850195 12:54430591-54430613 CTGAGAGAGAGAAAGGAAGAAGG + Intergenic
1097194983 12:57238239-57238261 CAGCGAGAAGGAAAGGGAGGCGG - Intronic
1097398091 12:59100699-59100721 CTCTGAAAGAGAATGGAAGGTGG + Intergenic
1097399083 12:59107953-59107975 CTCTGAAAGAGAATGGAAGGTGG - Intergenic
1097401495 12:59133962-59133984 CTGTGACAAAAACAGCAAGGGGG + Intergenic
1098027115 12:66215354-66215376 CTTTAAGAAAGAAAGGGAAGGGG - Intronic
1098076656 12:66738737-66738759 CTGTGAGAAGGAATGGAAATGGG + Intronic
1098083172 12:66811648-66811670 CAAGGAGAAAGAAGGGAAGGAGG - Intergenic
1098144772 12:67487295-67487317 CTGTGAAACAGCAAGGATGGTGG - Intergenic
1098333417 12:69377416-69377438 AAGTTAGAAAGAAAGAAAGGAGG - Intronic
1098579919 12:72087513-72087535 GGGACAGAAAGAAAGGAAGGAGG + Intronic
1099029428 12:77506788-77506810 ATGGGAGAAAGAAAGGATGGAGG - Intergenic
1099435441 12:82637017-82637039 CAGTGATAAAGAAAGAAAGGAGG + Intergenic
1099609385 12:84848304-84848326 AAGGAAGAAAGAAAGGAAGGAGG + Intergenic
1099710787 12:86222137-86222159 CTCTGAGAAAGAAAAGTATGAGG + Intronic
1099793676 12:87368412-87368434 GTGGCAGAAAGAAAGGTAGGTGG - Intergenic
1099902775 12:88733360-88733382 CTTTGAGATAGAAAGGAAAGAGG - Intergenic
1100100022 12:91091919-91091941 CAGTGAGAAGGAATGGATGGGGG + Intergenic
1100263720 12:92956375-92956397 GTTTGTGGAAGAAAGGAAGGAGG + Intergenic
1100272920 12:93043540-93043562 CTGTCTCAAAAAAAGGAAGGAGG - Intergenic
1100286257 12:93169528-93169550 AAGAGAGAAAGAAAGGAAGGAGG + Intergenic
1100481483 12:94983805-94983827 CTGTGAAGAATAAAGGAAGGAGG - Intronic
1100647627 12:96547881-96547903 ATCTGGAAAAGAAAGGAAGGAGG - Exonic
1100749666 12:97683678-97683700 CAGAAAGAAAGAAAGGGAGGGGG + Intergenic
1101027887 12:100631388-100631410 GTTTGTGGAAGAAAGGAAGGAGG + Intergenic
1101181103 12:102218876-102218898 GTGTGAGAAGCAGAGGAAGGAGG - Intergenic
1101502514 12:105317164-105317186 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1101588991 12:106109911-106109933 CTCTGAAAAAGAAAGGAAGAAGG - Intronic
1101672886 12:106893105-106893127 CTGGGACAAAGGAAGAAAGGGGG + Intergenic
1101679203 12:106948354-106948376 CTGAAAGCAAGAAAGGAAAGTGG + Intergenic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1101833486 12:108277908-108277930 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1101925641 12:108969305-108969327 GGGGGAGGAAGAAAGGAAGGAGG - Intronic
1102094656 12:110227754-110227776 GAGAGAGAAAAAAAGGAAGGAGG + Intergenic
1102101889 12:110285554-110285576 CTGAGAAAAATAAAGCAAGGGGG + Intronic
1102233843 12:111281891-111281913 GCCTGAGAAAGAAGGGAAGGAGG + Intronic
1102252949 12:111399889-111399911 CTGTCAGAAAGAAAGAAAGAAGG + Intergenic
1102552576 12:113702337-113702359 TTGAAAGGAAGAAAGGAAGGAGG - Intergenic
1102717368 12:114986114-114986136 GAGGGAGAAAGAGAGGAAGGAGG - Intergenic
1102764715 12:115422895-115422917 AAGGAAGAAAGAAAGGAAGGAGG + Intergenic
1102764733 12:115422967-115422989 AGGGGAGAAAGAAAGGAGGGAGG + Intergenic
1102799151 12:115716459-115716481 CTGTGAAGAATAAAGGAAGCAGG + Intergenic
1102900038 12:116629346-116629368 CTGTCTCATAGAAAGGAAGGAGG + Intergenic
1103245749 12:119455725-119455747 CTCTGAAAAAGAAAGAAAGAAGG + Intronic
1103245775 12:119455939-119455961 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1103251630 12:119504998-119505020 ATGGAAGAAAGAAAGAAAGGAGG - Intronic
1103444348 12:120984472-120984494 GTGGGAGAGAGAAGGGAAGGAGG + Intronic
1104159978 12:126168664-126168686 CTGAGAGAAGGGAAGGAATGAGG + Intergenic
1104243092 12:127010141-127010163 CTGAAAGAAAGAAGGGAAGTAGG - Intergenic
1104506700 12:129338972-129338994 CAGAGAGAGAGAAAGGAGGGAGG + Intronic
1104668885 12:130667096-130667118 ATGGGAGAAAAAAAGGAATGAGG + Intronic
1104870726 12:131993530-131993552 ATGTGAGAAAATAAGGAAAGCGG - Intronic
1104975322 12:132549574-132549596 CTCTGAGAGAGGCAGGAAGGAGG + Intronic
1105328220 13:19389601-19389623 CTGTAAGAAAGTAAGGCCGGGGG - Intergenic
1105812938 13:24010675-24010697 ATGGGAGGAAGAAAGGATGGAGG - Intronic
1106783548 13:33085201-33085223 AAAGGAGAAAGAAAGGAAGGAGG + Intergenic
1106823005 13:33487469-33487491 CTGTGAAAAGAAAAGAAAGGGGG + Intergenic
1107278532 13:38705843-38705865 CTGTGAGAAAGACAGGAGAAAGG - Intronic
1107341166 13:39407922-39407944 TTCTGAGAATGAATGGAAGGTGG + Intronic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1107347806 13:39481669-39481691 CTGTAACACAAAAAGGAAGGGGG + Intronic
1107966981 13:45605750-45605772 CCGTGATAAAGAAAGTAAAGAGG + Intronic
1107979766 13:45723431-45723453 ATGAGAGAAAGAAAGGACTGAGG - Intergenic
1108043721 13:46363213-46363235 CCTAGACAAAGAAAGGAAGGAGG + Exonic
1108231187 13:48343873-48343895 CTATGATACAGAAAGGAATGGGG - Intronic
1108296644 13:49026983-49027005 CTGTGAAATAGAAAGTAAAGGGG + Intronic
1109214606 13:59574315-59574337 AAGAGAGTAAGAAAGGAAGGAGG + Intergenic
1109463299 13:62692516-62692538 GTCTCACAAAGAAAGGAAGGGGG - Intergenic
1109512831 13:63402019-63402041 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1110137758 13:72089398-72089420 GTGTAAGGAAGAGAGGAAGGGGG + Intergenic
1110290877 13:73805599-73805621 CTGTCAGAAGGAAGGGAGGGAGG + Intronic
1110459019 13:75723760-75723782 GAGTGAGAAGAAAAGGAAGGAGG + Intronic
1110474635 13:75899823-75899845 CTGTGAGAAGCTAAGGAGGGCGG + Intergenic
1110565105 13:76949924-76949946 CTGGGAGAGAGAAAGGATGGTGG - Intronic
1110683439 13:78343708-78343730 TTTTCAGAAAGAATGGAAGGGGG + Intergenic
1110879371 13:80552578-80552600 GAAAGAGAAAGAAAGGAAGGAGG + Intergenic
1110921466 13:81092011-81092033 CTTTGGGAAACAAAGGTAGGAGG - Intergenic
1111150039 13:84240983-84241005 TAGTAAAAAAGAAAGGAAGGAGG + Intergenic
1111174173 13:84571690-84571712 ATGGAACAAAGAAAGGAAGGAGG - Intergenic
1111209222 13:85054396-85054418 ATGTGAGAAAGAAATGATGTAGG + Intergenic
1111465537 13:88603922-88603944 ATGTGAGAAGGAGAGGAATGAGG + Intergenic
1111734888 13:92125559-92125581 ATGGGAGAGAGAAAGGGAGGGGG + Intronic
1111886999 13:94034183-94034205 CTGAGAGAAAGAAAGAAAGAAGG + Intronic
1112246581 13:97740646-97740668 AGGAGAGAAAGAAGGGAAGGAGG + Intergenic
1112452030 13:99521459-99521481 TCGTGAGAAAGCAGGGAAGGTGG - Intronic
1112646029 13:101332765-101332787 ATGTGAGAAATAAAGGAAATAGG + Intronic
1112693840 13:101925924-101925946 CTGTGAGCCAGGAAGGCAGGTGG - Intronic
1112714673 13:102170032-102170054 CAGTGAGGAAGACAGGAAAGGGG + Intronic
1112925087 13:104663898-104663920 CTGAGAGTGAGAAAGGAAGCTGG - Intergenic
1112945893 13:104926485-104926507 TTGTGAGAAAGAGTGGGAGGGGG + Intergenic
1112962343 13:105142126-105142148 GAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1113077820 13:106485326-106485348 AGGTGAGAAAGGAAGGAAGAAGG - Intergenic
1113094145 13:106645912-106645934 GAGAGAGAGAGAAAGGAAGGAGG - Intergenic
1113207289 13:107931560-107931582 AGGTAAGAAAGAAAGGAGGGAGG + Intergenic
1113221422 13:108107971-108107993 GAGAGAGAAAGAAAGGAAGGAGG + Intergenic
1113593639 13:111517336-111517358 CTGTGACAAGGAGAGGGAGGCGG + Intergenic
1114490697 14:23099960-23099982 CAGTGCTTAAGAAAGGAAGGGGG + Exonic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114564403 14:23619017-23619039 CTGAGGGGAAGAAAAGAAGGTGG - Intergenic
1114953059 14:27781371-27781393 CTGGGAAAAAGGAAGTAAGGTGG - Intergenic
1115172091 14:30520132-30520154 ATGTGAGACAGAAAAGAAGCAGG - Intergenic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1116732486 14:48641671-48641693 CTGGGAGAAAGAGTGGGAGGGGG + Intergenic
1117024801 14:51608517-51608539 CTGAGAGAAGGAAGGGGAGGTGG - Intronic
1117265778 14:54085354-54085376 CTGTAAGCAAGAAAGGAATTTGG + Intergenic
1117278402 14:54213049-54213071 CTGTCAGGAAGAAAGGAAAAAGG - Intergenic
1117517641 14:56518341-56518363 GAGGGAGGAAGAAAGGAAGGAGG - Intronic
1117579267 14:57135860-57135882 CATTCAGAAAGAAAGGAATGAGG + Intergenic
1117667332 14:58070288-58070310 CTTTGAGTCAAAAAGGAAGGTGG + Intronic
1117869358 14:60183734-60183756 GTGTGAGAATGCAAGCAAGGAGG + Intergenic
1117881395 14:60316591-60316613 CTCTGAGAGAGAAAGGAACATGG + Intergenic
1118036792 14:61877029-61877051 CTGAGTGGAAGAAAGGTAGGAGG - Intergenic
1119129962 14:72163042-72163064 TTGGGAGAAAGAATGGGAGGTGG + Intronic
1119193130 14:72697820-72697842 GAGTGAGTAAGAAAGCAAGGAGG + Intronic
1119638399 14:76294904-76294926 ATGTGTAGAAGAAAGGAAGGAGG - Intergenic
1119680005 14:76585103-76585125 CTGGGAGAAGGGAAAGAAGGAGG + Intergenic
1120202546 14:81553649-81553671 CTGTCAAAAAGAAAGAAAGAAGG - Intergenic
1120204074 14:81568753-81568775 GAGTGGGAAAGAAAGGAAGGAGG + Intergenic
1120285384 14:82493815-82493837 CTGGAAGAAAGAAAATAAGGGGG + Intergenic
1120826344 14:88959218-88959240 CTGTCTGAAAGAAAGAAAGAAGG + Intergenic
1120856994 14:89221379-89221401 AAGAGAGAAAGAAAAGAAGGTGG - Intronic
1120860066 14:89247004-89247026 ATGGAAGAAAGAAAGGAAAGAGG - Intronic
1120903131 14:89593108-89593130 GAGAGAGAGAGAAAGGAAGGAGG + Intronic
1120974454 14:90236329-90236351 CTTTGAGAAAGAAAGAAGGAAGG - Intergenic
1120984345 14:90320639-90320661 TTGTGAGAAAGAAGGAAAAGAGG + Intronic
1121296712 14:92832331-92832353 TTATAAGAAAGAAAGGCAGGTGG + Intronic
1121788263 14:96679477-96679499 CTGTGAAAAAATCAGGAAGGAGG - Intergenic
1121843866 14:97156274-97156296 CTGAGAGGAAGAAAGGAAGGAGG - Intergenic
1121917041 14:97844709-97844731 CTTTGTAAAAGGAAGGAAGGAGG + Intergenic
1122281606 14:100626149-100626171 ATGTGAGAAGGACAGGAATGTGG - Intergenic
1122546003 14:102523262-102523284 CTGTCAAAAAGAAAGGAAAGAGG + Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1123674257 15:22692752-22692774 ATGGGAGAGAGAAAGGGAGGGGG + Intergenic
1123910746 15:24964539-24964561 CTTTGGGAAAGAAACCAAGGCGG - Intronic
1124069490 15:26378365-26378387 AAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1124069559 15:26378700-26378722 AAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1124103449 15:26716699-26716721 CTGTGAAAGAGAAAGGCAGTTGG - Intronic
1124201701 15:27684022-27684044 CTCTGAGAAAGAACAGCAGGTGG + Intergenic
1124326269 15:28765741-28765763 ATGGGAGAGAGAAAGGGAGGGGG + Intergenic
1124469930 15:29975266-29975288 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1124992827 15:34692743-34692765 CTTTGAGAAAGGAAAGAACGGGG - Intergenic
1125089650 15:35775283-35775305 GAGTAAGAAAGGAAGGAAGGCGG - Intergenic
1125289459 15:38129916-38129938 CTGAAAGGAAGAAAGGAGGGAGG - Intergenic
1125508492 15:40280943-40280965 GTGGGAGAAGGAAAGGACGGAGG - Intronic
1126123328 15:45272798-45272820 GTGTGTGAGAGAAAGGAATGGGG - Intronic
1126446383 15:48749674-48749696 CTGTTAAAAAAAAATGAAGGTGG + Intronic
1126853957 15:52819186-52819208 TTTTGAGAAAGAGAGGGAGGAGG + Intergenic
1127467626 15:59259599-59259621 CTGTAAGAAAGACACGAAGATGG + Intronic
1127610181 15:60629108-60629130 CTGTGAGACAGAGTGGCAGGTGG - Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1127921305 15:63496441-63496463 CGGTGAGAAAGTAAGGAAAGGGG - Intergenic
1128043962 15:64600635-64600657 CTGAAAGAAAGAAAGAAAGCAGG + Intronic
1128276529 15:66358409-66358431 CAGAGAGAAAGAAAGAAAAGTGG - Intronic
1128452754 15:67815626-67815648 CTGTGAAAAAGAAATAAAGCAGG - Intergenic
1128706063 15:69838120-69838142 CTGAGAGAGTGACAGGAAGGGGG - Intergenic
1128968835 15:72087752-72087774 ATATGAGAAAGAAAGGAGGAAGG - Intronic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1129001088 15:72334707-72334729 ATGTAAGAAAGAAAAAAAGGGGG - Intronic
1129144414 15:73633756-73633778 CGGGGACAAAGAGAGGAAGGAGG - Intronic
1129354194 15:74978246-74978268 CTCTGAGACAGGTAGGAAGGAGG + Intronic
1129537163 15:76323121-76323143 CAGAGAGAAAGATAGAAAGGGGG + Intergenic
1129779791 15:78263131-78263153 CTGTGAGAAAGGCAGGCAAGTGG + Intergenic
1130107865 15:80942604-80942626 CTTTGCAAAAGAAAGGCAGGAGG - Intronic
1130332555 15:82933554-82933576 CTGTGAGAATGATGAGAAGGTGG - Intronic
1130420953 15:83746403-83746425 CTGTTAGCAAAAAAGAAAGGAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130763847 15:86850388-86850410 ATGTGTGAAAAACAGGAAGGGGG - Intronic
1130855998 15:87840732-87840754 AGGGGAGGAAGAAAGGAAGGAGG + Intergenic
1130900293 15:88201957-88201979 CTATGACAAAGAAATGAGGGAGG - Intronic
1130987539 15:88854605-88854627 CAGGGAGAAAGGAAGGAGGGAGG - Intronic
1131205085 15:90437780-90437802 CTTTGAGAAAGAGAGGCAGGAGG - Intronic
1131442498 15:92469530-92469552 CTGTGAGACAGCAGGAAAGGAGG + Intergenic
1131499686 15:92950007-92950029 CAGTGGAAAACAAAGGAAGGGGG + Intronic
1131582500 15:93658509-93658531 TTGAGAAAAAGAAAGGCAGGAGG + Intergenic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1132156784 15:99501524-99501546 TGGTGAGAAAGAGAGGAAAGAGG - Intergenic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1133787219 16:8982903-8982925 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1134054484 16:11160948-11160970 CAGTGAGATAGAAATGAATGTGG - Intronic
1134191592 16:12125525-12125547 CTGTGAGAAACAGAGGACGATGG - Intronic
1134617502 16:15662880-15662902 ATGCAAGAAAGAAAGGAAGGTGG - Intronic
1134655284 16:15943577-15943599 CAGCGAGAAAGAAAGAAGGGAGG - Intergenic
1134745231 16:16582642-16582664 AGGAGAGAAAGGAAGGAAGGAGG - Intergenic
1135000246 16:18771133-18771155 AGGAGAGAAAGGAAGGAAGGAGG + Intergenic
1135479013 16:22805341-22805363 GTATGAGAAAGAAAGGAATCAGG + Intergenic
1135491528 16:22913755-22913777 CTTTGAGAAACCAAGGCAGGAGG + Intronic
1135627943 16:24012497-24012519 CAGTGAGACAGAGAGGAAGCAGG - Intronic
1135830455 16:25768396-25768418 CAGAGAGAGGGAAAGGAAGGGGG - Intronic
1135929161 16:26721962-26721984 ATCTCAAAAAGAAAGGAAGGAGG + Intergenic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136948908 16:34691225-34691247 AAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1137093323 16:36221759-36221781 AAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1137219821 16:46437518-46437540 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1137408469 16:48208323-48208345 CTGTGAGGAAGAAAGCAGTGGGG + Intronic
1137514482 16:49131126-49131148 CTTTGGGAAAGCAAGGAGGGTGG + Intergenic
1137515285 16:49138150-49138172 CTGTCAGCAAGCAAGGGAGGAGG - Intergenic
1137693334 16:50445242-50445264 GTGGGAGAAAGAAAAGAGGGAGG + Intergenic
1137724558 16:50648215-50648237 CTGTGAGAAGGACAGGAATGAGG - Intergenic
1137761924 16:50948049-50948071 CTGTGAGGAAGACAGAAGGGTGG - Intergenic
1137765533 16:50975030-50975052 CCGAGAGCCAGAAAGGAAGGTGG + Intergenic
1137819286 16:51428284-51428306 CTGTCAGAAAGAAAGAAAGAAGG - Intergenic
1137849282 16:51722602-51722624 GAGTAAGAAAGAAAGGAGGGAGG + Intergenic
1137906491 16:52327405-52327427 CTGGGAGGAAGAAACGAATGAGG + Intergenic
1137942864 16:52705828-52705850 GTGGGAGAAAGAATTGAAGGAGG + Intergenic
1137977084 16:53041122-53041144 CTGGATGAAAGGAAGGAAGGAGG + Intergenic
1138100709 16:54250046-54250068 CTCTGACATAGACAGGAAGGTGG + Intronic
1138484107 16:57325052-57325074 ATGTGAGAGAAAAGGGAAGGAGG + Intergenic
1138566247 16:57835082-57835104 CTGTGAGTAAGAACGGAGGCGGG + Intronic
1139151251 16:64384577-64384599 GAGAGAGAAAGAAAGTAAGGGGG - Intergenic
1139320407 16:66109696-66109718 AACAGAGAAAGAAAGGAAGGGGG + Intergenic
1139419304 16:66840258-66840280 CTGGGGGAAAGAATAGAAGGAGG + Intronic
1139685083 16:68597165-68597187 CTTTGAGAATGAAAGGAGAGGGG + Intergenic
1139834604 16:69828210-69828232 AGGAGGGAAAGAAAGGAAGGTGG - Intronic
1140191814 16:72823975-72823997 CTGTGACAAAGAATGGAAAGGGG - Intronic
1140604776 16:76522570-76522592 GAGAGAGAAAGAAAGGAGGGCGG - Intronic
1140656688 16:77148416-77148438 CTGTGGGAAAGATAGAAAGATGG + Intergenic
1140684740 16:77422562-77422584 GAGGGAGAAAGAAAGGAAGGAGG + Intronic
1140794762 16:78426903-78426925 CTGTGAGAAGCCAAGGCAGGCGG - Intronic
1141019461 16:80481461-80481483 ATGAGAGAAAGAAAGCAAGCTGG + Intergenic
1141043212 16:80690194-80690216 CTGTGAGAAACAACGGCAGCGGG + Intronic
1141226163 16:82117991-82118013 CAGAAAGAAAGAAAGAAAGGAGG - Intergenic
1141255883 16:82402002-82402024 CTTTGAGAAAGAAGGCCAGGGGG + Intergenic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1141732788 16:85833997-85834019 CTGTGTCAAAGGAAGGAAGGAGG + Intergenic
1141747759 16:85937459-85937481 CTGTGAACAAGGAAGAAAGGAGG + Intergenic
1141756777 16:85996730-85996752 CAGTAAGAGAGGAAGGAAGGAGG + Intergenic
1142109925 16:88325817-88325839 ATGCGTGGAAGAAAGGAAGGAGG - Intergenic
1142264490 16:89057525-89057547 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142264518 16:89057615-89057637 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142361117 16:89627574-89627596 CAGAGAGAGAGAGAGGAAGGAGG + Intronic
1142534551 17:605445-605467 CTGAGGGACAGAAAGGAAGATGG + Intronic
1142958145 17:3535141-3535163 GGGAGAGAAAGGAAGGAAGGAGG - Intronic
1143029123 17:3957706-3957728 CTGGGAGAGAGCAAGGAAGGAGG - Intronic
1143254050 17:5542782-5542804 GAGAGAGAAAGAAAGGAGGGAGG - Intronic
1143361203 17:6372767-6372789 CAGAGAGAAAAAAAAGAAGGAGG + Intergenic
1143504444 17:7356048-7356070 CCGTGAGTAGGAAAGGAAAGGGG + Exonic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1143673721 17:8415088-8415110 GAGGGAGGAAGAAAGGAAGGTGG - Intronic
1143965780 17:10755760-10755782 GAGGGAGAAAGAGAGGAAGGGGG - Intergenic
1143987086 17:10924092-10924114 TCTGGAGAAAGAAAGGAAGGGGG - Intergenic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144217630 17:13070416-13070438 GAGAGAGAAAGAAAGGGAGGGGG + Intergenic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG + Intergenic
1144402894 17:14923683-14923705 CTGACAGAAAGGAAGGCAGGTGG - Intergenic
1144512994 17:15893506-15893528 CAGGGAGGAAGAAAGGGAGGAGG - Intergenic
1145692356 17:26755759-26755781 AAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1145709086 17:26952406-26952428 GAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1145764100 17:27446154-27446176 ATGGGAGGAAGGAAGGAAGGAGG + Intergenic
1145775316 17:27523959-27523981 CTGTTAGGAAGAAAGGAGAGTGG + Intronic
1145931583 17:28689829-28689851 CTGTTAGAAAGGAGGAAAGGGGG - Intronic
1146128545 17:30249639-30249661 GTGTGTGATAGAAAGGAATGGGG - Intronic
1146587969 17:34099235-34099257 AAGAGAGAAAGGAAGGAAGGAGG + Intronic
1146587994 17:34099466-34099488 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1146661157 17:34665972-34665994 CAGTGAGGAAGAAAGGAGAGAGG + Intergenic
1146697041 17:34917269-34917291 CTGTCACAAAGAATGGAGGGTGG + Intergenic
1146981267 17:37164053-37164075 GTGAGAGACAGAAAGAAAGGGGG - Intronic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147180728 17:38683908-38683930 CTTTGAGAGACAAAGGAAAGAGG + Intergenic
1147444138 17:40464488-40464510 TTGGGAGGAAGGAAGGAAGGGGG + Intergenic
1147530194 17:41269070-41269092 ATGGAAGGAAGAAAGGAAGGAGG + Intergenic
1147590442 17:41679869-41679891 GAGAGAGAAAGAAAGGAGGGAGG + Intergenic
1147881496 17:43656951-43656973 CGGGGAGAAAGAAAGAAAGCAGG - Intronic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148442446 17:47718481-47718503 CTGAGTGACAGAGAGGAAGGAGG - Intergenic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148661768 17:49339973-49339995 CTTTGAGAAACAGAGGCAGGTGG - Intronic
1148758703 17:49988084-49988106 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1149411964 17:56417853-56417875 CTTGAAGAAAGAAAAGAAGGTGG - Intronic
1149444313 17:56701781-56701803 GGGTGAGAAAGGGAGGAAGGAGG + Intergenic
1149516593 17:57285493-57285515 AAATCAGAAAGAAAGGAAGGTGG + Intronic
1150071763 17:62156989-62157011 CAGTGACAGAGAAAGGAAGAAGG - Intergenic
1150159522 17:62883992-62884014 CTGTGAGAAATAAAGGTCTGTGG + Intergenic
1150306405 17:64089016-64089038 CTCTGAGAAAAAGAGGAATGTGG + Intronic
1150565661 17:66337168-66337190 TTGGGAGGAAGATAGGAAGGGGG + Intronic
1150649026 17:66997915-66997937 CCCTGAGAAGGAAGGGAAGGAGG + Intronic
1151078484 17:71301467-71301489 AAGGGAGGAAGAAAGGAAGGAGG - Intergenic
1151276529 17:73038729-73038751 GAGAGAGAAAGAAAGGAGGGAGG + Intronic
1151484509 17:74389927-74389949 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1151542947 17:74774344-74774366 CTGAGAGAATGAAAGGGAAGAGG + Intronic
1152286828 17:79417452-79417474 CTCTGAGAAAGAAAGGCCGTGGG - Intronic
1152331026 17:79673107-79673129 ATCTGAGAAGGATAGGAAGGGGG + Intergenic
1152350569 17:79781943-79781965 CTGAGAGACAGGAAGAAAGGGGG - Intronic
1152356558 17:79810388-79810410 CGGGGAGAAAGAAAGGGAGGGGG - Intergenic
1152457246 17:80423497-80423519 CTGCCAGAGAGAAAGGAGGGTGG - Intronic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153289839 18:3489936-3489958 CTGTGAAGAAGAAAGAAAGAAGG + Intergenic
1153346453 18:4031255-4031277 GTTTGAAAAAAAAAGGAAGGTGG + Intronic
1153567091 18:6429553-6429575 CAGAGAGAAAAAAATGAAGGAGG - Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1153777418 18:8466310-8466332 AAGAGAGAAAGAAAGGAGGGAGG + Intergenic
1154111724 18:11574820-11574842 GAGAGAGAGAGAAAGGAAGGAGG + Intergenic
1154126653 18:11698024-11698046 GAGTGAGAAAGGAAGGGAGGAGG + Intronic
1154130850 18:11735770-11735792 AAGAGAGAAAGAAAGGAGGGAGG + Intronic
1154943342 18:21136738-21136760 ATGTAAGAAATAAAAGAAGGTGG - Intergenic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155179929 18:23335644-23335666 CTGTCAGAAACAGAGAAAGGTGG - Intronic
1155323119 18:24638368-24638390 CTGAGAGACAGGAAGGTAGGAGG + Intergenic
1155405268 18:25480975-25480997 ATGTCAGGAAGAAAGGAAAGAGG - Intergenic
1155422310 18:25668448-25668470 CTATGAGAGAAAAAGGAAAGGGG + Intergenic
1156457118 18:37301077-37301099 CAGGCAGATAGAAAGGAAGGGGG + Intronic
1156736836 18:40270304-40270326 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1157187474 18:45552822-45552844 CTGGGGGAAAGAAAGCAAAGGGG + Intronic
1157327352 18:46678687-46678709 CAGGGAGAAAGGAAGGAGGGAGG + Intronic
1157583588 18:48787348-48787370 TAGGGAGAAAGGAAGGAAGGAGG + Intronic
1157935490 18:51867512-51867534 CTGAGACAAAGAAAGCAAGGAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158100765 18:53827664-53827686 CTGTCACAAAGACAGTAAGGGGG - Intergenic
1158106937 18:53896097-53896119 TTGTGAAGAACAAAGGAAGGAGG + Intergenic
1158202244 18:54954032-54954054 AAGAAAGAAAGAAAGGAAGGAGG - Intronic
1158339928 18:56454853-56454875 AGCAGAGAAAGAAAGGAAGGAGG + Intergenic
1158584825 18:58723025-58723047 CTTTGAAAAAAAAAGAAAGGGGG - Intronic
1158601748 18:58862526-58862548 CTGTGAACAATAAAGGAACGAGG + Intergenic
1159013982 18:63086845-63086867 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1159093398 18:63874181-63874203 ATTTAAGAAAGGAAGGAAGGAGG - Intronic
1159099689 18:63944291-63944313 AGTTGAGCAAGAAAGGAAGGGGG + Intergenic
1159181635 18:64914037-64914059 AAGTGAGAGAGAAAAGAAGGGGG - Intergenic
1159232515 18:65627760-65627782 CTGTGGCAAAAAAAGGCAGGGGG - Intergenic
1159604210 18:70458157-70458179 ATTTGATAAAGAAAGGAAGTTGG - Intergenic
1159758410 18:72394404-72394426 TTGTGTTAAAGAAAGGAATGCGG + Intergenic
1159763399 18:72456270-72456292 CAGTGAGAAAGCAAGGACTGGGG - Intergenic
1159878848 18:73839051-73839073 CTGAGAAAAAGAAAGAAAGTTGG + Intergenic
1159931222 18:74315061-74315083 GTTTGAGAAAGACATGAAGGCGG - Intergenic
1159942804 18:74421464-74421486 GTTTGAGAGAGAAGGGAAGGGGG - Intergenic
1159972297 18:74669370-74669392 CACTGAGGAAGAAAGGAAGGAGG - Intronic
1160196377 18:76758881-76758903 ATGAGAGAGAGAAAGGAAGTGGG + Intergenic
1160253773 18:77228978-77229000 CTATGAAGAAGAAATGAAGGGGG + Intergenic
1160548338 18:79677202-79677224 CTGCGAGAGAGAAAGTAGGGGGG - Intergenic
1161139653 19:2639860-2639882 GAGGGAGAAAGGAAGGAAGGAGG + Intronic
1161141646 19:2651413-2651435 GAGGGAGGAAGAAAGGAAGGAGG - Intronic
1161434290 19:4253114-4253136 CTTTGAGAAGGCAAGGCAGGAGG + Intronic
1161656479 19:5518735-5518757 GAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1161757763 19:6146851-6146873 CTTTGAGAAACTAAGGGAGGAGG + Intronic
1161833376 19:6627032-6627054 GAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1162322577 19:9978836-9978858 CTTAGAGAAGGAAAGGATGGGGG - Intronic
1162563789 19:11433920-11433942 CTGTCAGAAAGAAAGAAGGCTGG + Intronic
1162594474 19:11616711-11616733 CTCTGTGAAAGTAAAGAAGGTGG + Exonic
1162783058 19:13017171-13017193 GGGTGAGAAAGAAAGGGAGCCGG + Intronic
1162826567 19:13255935-13255957 GAGAGAGAAAGAAAGGAGGGAGG - Intronic
1162826569 19:13255939-13255961 ATGAGAGAGAGAAAGAAAGGAGG - Intronic
1162846836 19:13399339-13399361 CTCTGAGCAAGGAAGGAGGGAGG - Intronic
1162984982 19:14264081-14264103 GAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1162994100 19:14322701-14322723 AAGAGAGAAATAAAGGAAGGAGG - Intergenic
1163095806 19:15056119-15056141 CTGTGAGACAGAAAGAATGCTGG - Exonic
1163488417 19:17603088-17603110 CTGGGGGAAAGAAAAGAGGGTGG + Exonic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1164711403 19:30359571-30359593 CGGGGAGACAGGAAGGAAGGTGG - Intronic
1166076810 19:40418390-40418412 CTGTCAGAAAGAAAGAAGGAAGG - Intergenic
1166115533 19:40651541-40651563 GAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1166173165 19:41046642-41046664 GTGAAAGAAAGGAAGGAAGGAGG - Intergenic
1166725267 19:45023436-45023458 CTGAAAGAAAGAAAGAAAGAAGG - Intronic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1166889690 19:45983101-45983123 ATGTGAGAAAGAGAGGCAGCTGG - Intergenic
1166974472 19:46596793-46596815 CAGTAAGAAAGAAAAAAAGGGGG - Intronic
1166994109 19:46711099-46711121 CTGTGAGAAATCAGGGAACGTGG - Intronic
1167158807 19:47754932-47754954 GTGGGAGGAAGGAAGGAAGGGGG - Intronic
1167217812 19:48176533-48176555 AAGTGAGAAAGAAAGGCGGGAGG - Intronic
1167231442 19:48286867-48286889 CCCTGTGAATGAAAGGAAGGTGG + Exonic
1167327828 19:48836269-48836291 GTGTGAGAAAGGAAGGATGGGGG - Intronic
1167554202 19:50183071-50183093 GAGAGAGAAAGAAGGGAAGGAGG - Intergenic
1167684055 19:50944474-50944496 GAGTGAGAGAGAAAGGGAGGCGG - Intronic
1168220359 19:54956125-54956147 GGGAGAGAAAGGAAGGAAGGAGG + Intronic
1168261857 19:55199712-55199734 GAGGGAGAAAGGAAGGAAGGAGG + Intronic
1168506570 19:56940139-56940161 CGGTGAACAAGAAAGGAAAGAGG + Intergenic
925436866 2:3846099-3846121 GAGGGAGAAAGGAAGGAAGGAGG - Intronic
925686528 2:6479237-6479259 CAGTGGAAAAGAAAGCAAGGGGG + Intergenic
925931451 2:8711545-8711567 CAGCAAGAAAGAAAGCAAGGAGG + Intergenic
925940488 2:8812540-8812562 AGGAAAGAAAGAAAGGAAGGAGG + Intronic
925946105 2:8865411-8865433 CTGTTATAAAGACAGGAAGGAGG - Intronic
925989866 2:9246010-9246032 CTGTGAAAAGGACAGGAGGGTGG + Intronic
926378672 2:12262099-12262121 TGGTGAGAAAGGAAGCAAGGGGG + Intergenic
926394854 2:12430430-12430452 AAGGGAGGAAGAAAGGAAGGAGG + Intergenic
926832425 2:16978280-16978302 CTGTGAGAAAGAAATGACTGTGG - Intergenic
926986212 2:18627104-18627126 ATGTGAGCAAAAGAGGAAGGGGG - Intergenic
927185148 2:20477013-20477035 GTGTGGGAAAGAAAAGAAGTTGG + Intergenic
927434723 2:23057418-23057440 GTGAGAGAGAGAAAGAAAGGAGG + Intergenic
927434725 2:23057422-23057444 GAGAGAGAAAGAAAGGAGGGCGG + Intergenic
927702101 2:25275362-25275384 CTGTGGGAAGGAGAGGAAGTGGG - Intronic
927808559 2:26169411-26169433 CTGGGGGAAAGAGAGGGAGGAGG - Intergenic
927877811 2:26670501-26670523 GTGGGAGAAGGGAAGGAAGGAGG + Intergenic
928168993 2:28991456-28991478 AGGTGACAGAGAAAGGAAGGAGG - Intronic
928175195 2:29028659-29028681 TAGTGAGAGAGAAAGGCAGGAGG + Intronic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928316019 2:30246824-30246846 CTGAAAGAAAGAAAGAAAGGAGG - Intronic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
929262389 2:39880268-39880290 GTATGAGAAAGAAAAGAAGTGGG - Intergenic
929339775 2:40801408-40801430 ATGTAAGAAAGAAAGGAAAAAGG - Intergenic
929431678 2:41892870-41892892 CAGAGAGAAGGAAGGGAAGGAGG + Intergenic
929448963 2:42023968-42023990 GAGGGAGGAAGAAAGGAAGGAGG + Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
929676136 2:43931891-43931913 GACTGAGAAGGAAAGGAAGGAGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929726884 2:44439135-44439157 CAGTGAGAAAAAAAAGATGGTGG - Intronic
930713243 2:54569160-54569182 CTGGGAAGAAGAAAGGAACGGGG + Intronic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931098882 2:58973214-58973236 GGGGGAAAAAGAAAGGAAGGTGG + Intergenic
931166733 2:59756863-59756885 GAGAGAGAAAGAAAGGAGGGAGG - Intergenic
931207634 2:60163581-60163603 CTGTGATACAAAAAGAAAGGAGG - Intergenic
931562715 2:63579982-63580004 GTGAGAGACAGAGAGGAAGGGGG - Intronic
931870450 2:66452680-66452702 CAGGCTGAAAGAAAGGAAGGGGG - Intronic
932097681 2:68866101-68866123 CAGTGACAAGGAGAGGAAGGAGG - Exonic
932392432 2:71407272-71407294 GTGTGACATAGAATGGAAGGTGG + Intronic
932453323 2:71830015-71830037 AAGTGAGAGGGAAAGGAAGGTGG + Intergenic
932484768 2:72077515-72077537 CTGTGAGCAACCAAGGATGGGGG + Intergenic
932564277 2:72895808-72895830 ATGTGAGAGAGAGAGGGAGGGGG - Intergenic
932759482 2:74430041-74430063 GTGGGAGGAAGAAAGGAGGGTGG + Intronic
932894767 2:75628818-75628840 CAGAGAGAAAGAACGGAAGTGGG - Intergenic
932963873 2:76447422-76447444 GTGTAAAAAAGAAAGGAGGGAGG - Intergenic
933276948 2:80294085-80294107 ATCAGAGAAGGAAAGGAAGGTGG + Intronic
933360907 2:81282628-81282650 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
933514178 2:83279570-83279592 CTGTCAGAATGACAGGAAAGAGG - Intergenic
933554372 2:83813445-83813467 CTGTGAGAAGGGATGGCAGGAGG - Intergenic
933603819 2:84360528-84360550 CTGTGAAAAAGCAAAGATGGTGG - Intergenic
934059196 2:88278709-88278731 CTTTGAGAGACCAAGGAAGGAGG - Intergenic
934303455 2:91798910-91798932 AAGAGAGAAAGAAAGAAAGGAGG + Intergenic
934329804 2:92053846-92053868 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
934468022 2:94283752-94283774 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
934484262 2:94688062-94688084 CTGGGAAAAAGGAAGTAAGGTGG + Intergenic
934578720 2:95420759-95420781 CTATGGGAAAGGAAGGAATGGGG + Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
934842039 2:97631653-97631675 CTGTCAGAAAGAAAGAAGGAAGG + Intergenic
934859454 2:97751795-97751817 CGGTGAGAAAGGGAGGAAGAGGG + Intergenic
934904316 2:98185686-98185708 CTGGGAGAAATAAAGGTAGATGG - Intronic
934974462 2:98790908-98790930 GTATGAGAAGGAAAGGATGGAGG - Intergenic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
935439719 2:103077788-103077810 GAGAGAGAAAGGAAGGAAGGAGG - Intergenic
935718876 2:105962008-105962030 CGCTCAGAATGAAAGGAAGGTGG - Intergenic
935800296 2:106689113-106689135 ATGTGTGAAAGAAAAGAAGGAGG + Intergenic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936233587 2:110725005-110725027 AAGGGAGAAAGGAAGGAAGGAGG + Intergenic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
936600194 2:113888517-113888539 GTGGGAGAATGAGAGGAAGGTGG - Intergenic
936659216 2:114523583-114523605 CTGAGAGAAGGAAAGAAAAGAGG + Intronic
936946986 2:117940055-117940077 CTCTGAGCAGCAAAGGAAGGTGG + Intronic
937159631 2:119747718-119747740 CTTGAAGAAAGAAAGGGAGGAGG + Intergenic
937176569 2:119942482-119942504 CTGTGGGAAAGGGAGTAAGGTGG - Intronic
937688915 2:124731568-124731590 AAGAAAGAAAGAAAGGAAGGAGG + Intronic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
937873308 2:126802096-126802118 CTATAAGAAAGAGGGGAAGGGGG - Intergenic
937891272 2:126940717-126940739 CAGTGGGAAAGTAATGAAGGCGG - Intergenic
937955678 2:127420616-127420638 GTGTGAGCAAGAAGGGATGGGGG - Intronic
938093926 2:128449666-128449688 CTGTAACCAAGAAAGGAGGGCGG + Intergenic
938186187 2:129234085-129234107 CTGTGAGAAAAAAGGCAAGTGGG + Intergenic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938509372 2:131924888-131924910 CTGATAGAAATAAAGGAATGTGG + Intergenic
938780777 2:134582829-134582851 CTGAGAGGAGGAAAGGTAGGGGG + Intronic
939542838 2:143514530-143514552 CTGTGAGAATGAAAACAAAGAGG - Intronic
939833594 2:147101629-147101651 GAGTAAGAAAGAGAGGAAGGTGG + Intergenic
939885408 2:147676093-147676115 CTGTGAGAGTCAAAGGAAGCTGG - Intergenic
939958014 2:148542792-148542814 CTGTGAGAATGAGACAAAGGAGG - Intergenic
939986479 2:148834080-148834102 GAGAGAGAAAGAAAGAAAGGAGG - Intergenic
940180399 2:150925352-150925374 CGATAAGAAAGAAAGGGAGGAGG - Intergenic
940448814 2:153812699-153812721 CTGAGATAAACAAAGGAAAGAGG - Intergenic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
941095036 2:161229409-161229431 CTCTGAGAATGAAGGGATGGAGG + Intronic
941400122 2:165020283-165020305 GAGAGAGAAAGAAAGAAAGGAGG - Intergenic
941565685 2:167103152-167103174 AAGGAAGAAAGAAAGGAAGGAGG + Intronic
942127761 2:172844492-172844514 CTGTAAGGAGGAGAGGAAGGAGG - Intronic
942384745 2:175430495-175430517 TTGTGAGACAGGGAGGAAGGGGG + Intergenic
942563101 2:177241021-177241043 CCCTGAGAATGACAGGAAGGTGG + Intronic
942579796 2:177405690-177405712 TGGTCAGAAAGACAGGAAGGTGG - Intronic
942629413 2:177939435-177939457 AAGGGAGGAAGAAAGGAAGGAGG + Intronic
943016451 2:182516658-182516680 AAGAGAGAAAGAAGGGAAGGAGG + Intronic
943512070 2:188838630-188838652 AAGTGAGAAAGAAAGGAAAAAGG + Intergenic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
943983415 2:194587707-194587729 AAGAAAGAAAGAAAGGAAGGTGG + Intergenic
944073051 2:195694942-195694964 CTGAGTGAAAGAAAGAAATGGGG + Intronic
944340310 2:198588381-198588403 TTGTGAGAAAGAAAAGAACACGG - Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944486602 2:200213361-200213383 CAGAAAGAAAGAAAGGAAAGAGG - Intergenic
944657192 2:201887664-201887686 CTGGGAGAATGAAGGGCAGGAGG + Intronic
944725850 2:202470459-202470481 TTGTAAGAAAGTAAGGAAAGAGG + Intronic
944885958 2:204062977-204062999 CTGTCAAAAAGAAAGAAAGAAGG - Intergenic
944916022 2:204361110-204361132 CAGGGAGGAAGAAAGGAAAGGGG - Intergenic
944916038 2:204361216-204361238 TTCTGAAAAAGAAAGGAAAGGGG - Intergenic
944964445 2:204914460-204914482 AAGAGAGAAAGAATGGAAGGAGG + Intronic
945507164 2:210656154-210656176 CACTGGGAAAGAAAAGAAGGTGG - Intronic
945530011 2:210941343-210941365 CTTTGAGAAAGAAAGTGAGAAGG + Intergenic
945893857 2:215459995-215460017 CTGGGAGACAGAAGAGAAGGAGG - Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946063873 2:216969269-216969291 GAGAGAGAGAGAAAGGAAGGAGG - Intergenic
946558298 2:220884095-220884117 ATTTGAGAAACAGAGGAAGGAGG - Intergenic
946884105 2:224205760-224205782 AGGTGAGAAGGAAAGGAAGATGG - Intergenic
946939869 2:224759516-224759538 TTGTTAGAAAAAAAGGCAGGAGG - Intergenic
947029912 2:225782506-225782528 CAGAGGGAAAAAAAGGAAGGAGG - Intergenic
947029973 2:225782701-225782723 AAGGGAGAGAGAAAGGAAGGAGG - Intergenic
947030189 2:225783446-225783468 GAGTGAGAAAGGAAGGAAGGGGG - Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947227748 2:227856712-227856734 CTGTGAGAAAGAATGGGAGCAGG - Intergenic
947531056 2:230908876-230908898 CCTTGAGAAAGAAGGCAAGGGGG - Exonic
947624823 2:231612908-231612930 CTGGGAGGGAGAAGGGAAGGGGG + Intergenic
947703797 2:232258280-232258302 CTGTGATTAAGAAAGAAAAGAGG + Intronic
947835586 2:233172484-233172506 CAGTGAAAATGAAAGAAAGGGGG + Intronic
947868924 2:233421633-233421655 CTGGAAGGAAGCAAGGAAGGAGG - Intronic
948041537 2:234905517-234905539 AAGAGAGAGAGAAAGGAAGGGGG + Intergenic
948094139 2:235320276-235320298 CTGTCTGAAAGAAAGAAAGAAGG - Intergenic
1168749301 20:270976-270998 CAGGAAGAAAGAAAGGAGGGAGG + Exonic
1169104586 20:2983661-2983683 GTGTGAGGAAGAAATCAAGGGGG + Intronic
1169245051 20:4018519-4018541 ATGAGAGAATGAACGGAAGGAGG + Intergenic
1169389757 20:5180210-5180232 CTGTGAGAGAGATAAAAAGGTGG + Intronic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1169899010 20:10534269-10534291 ATTGCAGAAAGAAAGGAAGGAGG - Intronic
1170404770 20:16024601-16024623 CTGAGAGAAAGAAAGAAGGCAGG - Intronic
1170589784 20:17763112-17763134 ATGAGAGAAAGAAAGGGAAGAGG - Intergenic
1170634280 20:18091330-18091352 CTGAAAGAAAGAAAGCAAGAAGG + Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171312139 20:24153085-24153107 CTTTAAGAAATAAAAGAAGGGGG - Intergenic
1171385783 20:24768632-24768654 AAGAGAGAAAGAAGGGAAGGCGG - Intergenic
1171400874 20:24872461-24872483 ATGTTAGAAGGAAAGGGAGGTGG + Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1171983911 20:31646069-31646091 CTGTGAGAGATAAAGGAGAGAGG + Intergenic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1172128536 20:32639960-32639982 TCGTGAGAATGAAAGGAAGCAGG - Intergenic
1173086597 20:39925208-39925230 CTGTGGGAGAGAGAGGAAGGTGG + Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173289487 20:41701913-41701935 TTGTGTGAAAGGAAGGAGGGAGG + Intergenic
1173457199 20:43212901-43212923 TTACGAGAAAGAAAGGAGGGAGG + Intergenic
1173702502 20:45085326-45085348 CTTTGAGAAGGAAGGGGAGGGGG - Intergenic
1174324206 20:49766283-49766305 GTGTGAGAGAGAAAAGAAGTTGG + Intergenic
1174389632 20:50210195-50210217 CTGTGGGAGAGTAAGGCAGGAGG - Intergenic
1174525661 20:51168663-51168685 GAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1175474910 20:59265361-59265383 GAGGGAGGAAGAAAGGAAGGAGG - Intergenic
1175480000 20:59304027-59304049 GGGTAAGAAAGAAAGGAGGGAGG - Intronic
1175554342 20:59837449-59837471 CTGAGGCAAAGAAAGGAGGGAGG - Intronic
1175581889 20:60106219-60106241 CTGTGGGAGAGCAAGGCAGGAGG - Intergenic
1176003138 20:62843143-62843165 CGGTGAGGAAGAAAGGAAGGGGG + Intronic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1176160622 20:63645971-63645993 GAGAGAGGAAGAAAGGAAGGAGG + Intronic
1176346089 21:5749124-5749146 CTGTGTGGAAGAAAAGAATGTGG + Intergenic
1176352903 21:5869708-5869730 CTGTGTGGAAGAAAAGAATGTGG + Intergenic
1176498738 21:7575331-7575353 CTGTGTGGAAGAAAAGAATGTGG - Intergenic
1176540410 21:8147194-8147216 CTGTGTGGAAGAAAAGAATGTGG + Intergenic
1176559361 21:8330239-8330261 CTGTGTGGAAGAAAAGAATGTGG + Intergenic
1176784113 21:13233672-13233694 CTGATAGAAATAAAGGAATGTGG - Intergenic
1176916271 21:14629465-14629487 CTGTGAGAATAAAATGAAGAAGG + Intronic
1177112577 21:17046745-17046767 CTGTGAGACAGAAAAGTAGCAGG - Intergenic
1177277131 21:18926892-18926914 CACTGAGAAAGCAAGGAAGGAGG - Intergenic
1177500874 21:21952977-21952999 ATCTGAGAAAGAAAGGAAGGGGG - Intergenic
1178016107 21:28347537-28347559 GAGGGAGAAAGAAAGGAAGGAGG - Intergenic
1178421773 21:32448981-32449003 AAGAGAGAAAGAAAGAAAGGAGG + Intronic
1178461818 21:32809272-32809294 AAGAAAGAAAGAAAGGAAGGAGG - Intronic
1178769755 21:35492126-35492148 CAGTGAGAAATAGAGGAAGAAGG - Intronic
1178780824 21:35602344-35602366 CTGGGAGAAATAAAGGTAAGAGG + Intronic
1178846662 21:36179739-36179761 GTGTGTGAGAGAAAGGGAGGGGG + Intronic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179088927 21:38245589-38245611 GAGAGAGAAAGAAAGAAAGGAGG + Intronic
1179116695 21:38499809-38499831 AAGAGAGAGAGAAAGGAAGGAGG + Intronic
1179459069 21:41521423-41521445 CTGGGTGACAGAAAGGAATGGGG + Intronic
1179986587 21:44925385-44925407 CAGAAAGAAAGAAAGGAAGAAGG + Intronic
1180070836 21:45435212-45435234 ATGGGAGGAAGAGAGGAAGGTGG + Intronic
1180904178 22:19396948-19396970 CTGTGAAGAAAAAAGGAATGTGG + Intronic
1181271269 22:21660234-21660256 TTGTGAGAATGAAATGAAAGGGG + Intronic
1182013890 22:27023001-27023023 CTGGGAGAAGGAGAAGAAGGTGG + Intergenic
1182110453 22:27719411-27719433 CAGTGGGAGAGAAAGGAGGGAGG - Intergenic
1182406511 22:30137567-30137589 ATGAAAGAAAGAAAAGAAGGAGG + Intronic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1182769109 22:32780978-32781000 GTGAGAGAGAGGAAGGAAGGAGG - Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183089974 22:35515486-35515508 GTGTGAGAAAAAAAGGGAGGGGG + Intergenic
1183148072 22:36013780-36013802 GTGTCAAAAAGAAAGGAGGGGGG + Intronic
1183398332 22:37586136-37586158 TTCTAAGAAAGAAAGGCAGGGGG - Intergenic
1183646680 22:39131289-39131311 CTGGGGGAAAGAAAGGCAGATGG + Exonic
1183852537 22:40602885-40602907 TTGTGAAGAAGAAATGAAGGGGG - Intronic
1184088825 22:42281980-42282002 CTGTGAGAGGGCAAAGAAGGTGG + Intronic
1184401416 22:44276769-44276791 CAGGGAGAAAGAACGGGAGGTGG + Intronic
1184495756 22:44840381-44840403 CTGTGAAAAAGATGGGAGGGAGG - Intronic
1184618305 22:45653441-45653463 CTGAGAGAAAGAAATAAACGAGG - Intergenic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1185051224 22:48555313-48555335 CTCTGAGAGCGAAAGGGAGGAGG - Intronic
1203245353 22_KI270733v1_random:63620-63642 CTGTGTGGAAGAAAAGAATGTGG + Intergenic
1203290082 22_KI270735v1_random:28141-28163 AAGTGAGAAAGAAGGGAAGGAGG - Intergenic
949343755 3:3057573-3057595 CTCTGAGAAAGAAGAAAAGGTGG - Exonic
949508783 3:4750723-4750745 AAGAAAGAAAGAAAGGAAGGGGG - Intronic
949757267 3:7426610-7426632 CTCTCAGAAGGACAGGAAGGTGG - Intronic
949768222 3:7550357-7550379 GAGAGAGAAAGGAAGGAAGGAGG - Intronic
949868006 3:8562592-8562614 CTGTGAGATAAATAGGAATGTGG + Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950080626 3:10219657-10219679 CTAAGAGAAAGAAAAGCAGGAGG - Intronic
950208791 3:11101900-11101922 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
950462148 3:13130983-13131005 GAGAGAGAAAGAAAAGAAGGAGG + Intergenic
950582141 3:13869576-13869598 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
951262568 3:20527846-20527868 TGGAGAGAAACAAAGGAAGGAGG + Intergenic
951949734 3:28186544-28186566 GTGAGAGAAGAAAAGGAAGGCGG - Intergenic
952590147 3:34942633-34942655 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
952710055 3:36421107-36421129 CAGAGAGGAAAAAAGGAAGGAGG - Intronic
952821089 3:37486258-37486280 CTCTGAGAAAGAAATGCAAGAGG + Intronic
953341133 3:42134981-42135003 CTTTGGGAAGGAAAGGCAGGAGG - Intronic
953567384 3:44044552-44044574 CTTTAAAAAAGTAAGGAAGGAGG + Intergenic
953731297 3:45450789-45450811 CTGTGTGAAAAACAGTAAGGTGG - Intronic
953900660 3:46840258-46840280 CTCTGAGAAAGAAAGAAGGAAGG + Intergenic
954155725 3:48684025-48684047 GAGAGAGAAAGAAAGGAATGGGG + Intronic
954584634 3:51722467-51722489 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
954612749 3:51954965-51954987 CTCTCAGAAAGAAAGGAGGCTGG - Intergenic
954656115 3:52195267-52195289 CTCTGAGAAGGAAGGGAGGGAGG + Intergenic
954659656 3:52220325-52220347 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
954967279 3:54622953-54622975 CTGTGATTAAGAAGGGGAGGAGG + Intronic
955060754 3:55489642-55489664 CTGGGGGAAAGAAAGCAAGTTGG - Intronic
955559656 3:60174978-60175000 CTGTGTGAACGAAAGGATAGGGG + Intronic
955832619 3:63020443-63020465 GAGAGAGAAAGAAAGGAGGGAGG + Intergenic
955914575 3:63893891-63893913 CTGTGAGAGTGAAAGCAAGGTGG + Intronic
956162557 3:66370619-66370641 TGGAGAGGAAGAAAGGAAGGAGG - Intronic
956718327 3:72097892-72097914 CTGGGAGAGAGAAAGGTTGGAGG + Intergenic
956783423 3:72622846-72622868 CAGTGAAAGAGAAAGGAAAGGGG - Intergenic
956903413 3:73740816-73740838 ATGGGAGAAAGAAAGGGAGGAGG - Intergenic
957049514 3:75400613-75400635 GAGAGAGAAAGAAAGAAAGGAGG - Intergenic
957193877 3:77042702-77042724 CGGAGAGAAAGAAGGGAGGGAGG - Intronic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
957249467 3:77754704-77754726 TTTTGAAAAAGAAAGGGAGGAGG + Intergenic
957287317 3:78232966-78232988 CTAAAAGAAAGACAGGAAGGAGG + Intergenic
957437296 3:80194987-80195009 CTGTGAGAAGAAAATCAAGGTGG - Intergenic
958254045 3:91303921-91303943 TAGTGAGAAAGAAAGAAAAGTGG + Intergenic
958427715 3:93998320-93998342 ATAAGAGAAAGAAAGGAAAGAGG - Intronic
958505291 3:94968963-94968985 ATGGGAGATAAAAAGGAAGGGGG - Intergenic
958513929 3:95088135-95088157 CTGAGGGTGAGAAAGGAAGGAGG - Intergenic
958884952 3:99715394-99715416 ATGTGAGAAACAAGGGAAAGAGG + Intronic
959216760 3:103460113-103460135 TTTTGTGAAAGAAAGTAAGGAGG - Intergenic
959445625 3:106435561-106435583 GAGAGAGAAAGAAAGAAAGGGGG + Intergenic
959445666 3:106435817-106435839 GAGAAAGAAAGAAAGGAAGGAGG + Intergenic
959570922 3:107882788-107882810 CTGAGACACAGAAAGGAAGTCGG + Intergenic
959578499 3:107960730-107960752 GAGGGAGAGAGAAAGGAAGGGGG + Intergenic
960062560 3:113339332-113339354 CTGAAAGAAGGAAAGGAATGAGG - Intronic
960110393 3:113839280-113839302 GGCTGAGAATGAAAGGAAGGGGG - Intronic
960585535 3:119317695-119317717 GAGGGAAAAAGAAAGGAAGGAGG + Intronic
960617368 3:119608146-119608168 ATGAGAGAAAGAAAGGGAGAAGG + Intronic
960721029 3:120624545-120624567 CTCTGAGAAAGAAAGAAAGAAGG + Intergenic
960807869 3:121601272-121601294 GTTTGACAATGAAAGGAAGGGGG - Intronic
960897788 3:122523555-122523577 GAGTGAGAAAGGAAGGAAGGAGG - Intergenic
960987565 3:123290677-123290699 TTGAGAGAACCAAAGGAAGGAGG - Intronic
961175814 3:124834405-124834427 CTGAAAGAAAGAAAGAAAGAAGG + Intronic
961797882 3:129422805-129422827 CTGTGAGACAAAAAGGAATGGGG - Intronic
961881827 3:130067050-130067072 GAGAGAGAAAGAAAGAAAGGAGG - Intergenic
962103120 3:132363605-132363627 CTGTGGAAAAGATAGGATGGTGG - Intronic
962355998 3:134694736-134694758 CTCAGTGAAAGAAATGAAGGGGG - Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
962442025 3:135429273-135429295 CTGTGAGAAGGAACGGTAGTGGG + Intergenic
962627442 3:137239879-137239901 CATGGAGAAAGAGAGGAAGGTGG + Intergenic
962669229 3:137688121-137688143 CTGCTAGAAGGAATGGAAGGTGG - Intergenic
962711667 3:138091611-138091633 GTGAGAGCAAGAAAGGAAGGTGG + Intronic
962723940 3:138203556-138203578 CTGTTAGAGAAAAAGGGAGGGGG + Intronic
962789860 3:138801485-138801507 CTTTGAGACACTAAGGAAGGAGG + Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
962914763 3:139890682-139890704 GTGTGAGAGAGGAAGGAAGCAGG - Intergenic
963115611 3:141726529-141726551 GAGAAAGAAAGAAAGGAAGGAGG + Intergenic
963235500 3:142952035-142952057 CTGTGAAAAAGAAGGGGGGGGGG + Intronic
963258076 3:143166199-143166221 CGGAGAAAAAGAAAGAAAGGAGG - Intergenic
963754957 3:149225326-149225348 CTGTGAAAAAGAAAGCAGCGTGG - Intergenic
963873371 3:150444507-150444529 CTGTTGGCAAGAAAGGAAGAAGG + Intronic
963934170 3:151035402-151035424 CTGGGGGAAGGAAAGGTAGGAGG - Intergenic
964002960 3:151798249-151798271 ATGTAAGAAAGAAAGAAAGAAGG - Intergenic
964042875 3:152284479-152284501 CTGTCAGAAAGAAAGCACTGAGG - Intronic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
965103474 3:164332539-164332561 CTGTGAGGGAGAGAGGAAGTGGG + Intergenic
965366543 3:167807694-167807716 ATGTAAGAAAGAAAGAAGGGAGG + Intronic
965456471 3:168907420-168907442 TGGTGTGAGAGAAAGGAAGGAGG + Intergenic
965911919 3:173788895-173788917 CAGTAAGAAAGAAAGGATGTTGG + Intronic
966002915 3:174972095-174972117 CTGTGAGTAAGAAAATATGGAGG - Intronic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
966395123 3:179494552-179494574 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
966517790 3:180838181-180838203 CTGAAAGAAAGGAAGGAGGGAGG + Intronic
967539067 3:190643385-190643407 AAATGAGAAAGGAAGGAAGGTGG + Intronic
967543025 3:190691275-190691297 GAGAGAGAAAGAAAGGAAGGAGG + Intergenic
967553743 3:190830990-190831012 TGGTGAGAAAGAACGGAAAGAGG + Intergenic
967906092 3:194501601-194501623 GAGTGACAAAGAAAGGAAGGAGG + Intergenic
968081512 3:195849680-195849702 CTGTGTGAGAGAAAATAAGGAGG - Intergenic
968276121 3:197441685-197441707 CTGAAAGAAAGAAAGGAAGAAGG + Intergenic
968278590 3:197458971-197458993 ATGTGAGATAGAAATGAAGATGG - Intergenic
968284497 3:197500149-197500171 GAGGGAGAGAGAAAGGAAGGTGG + Intergenic
968441551 4:626916-626938 CTCTGAGGAAGAAGGGGAGGGGG + Intronic
968973210 4:3807139-3807161 CTGTCAAAAAGAAAGAAAGAGGG - Intergenic
969436129 4:7190627-7190649 GTGGGAGAAAGAAAGAAAGAAGG - Intergenic
969480832 4:7446057-7446079 CAGGGAGGAAGGAAGGAAGGGGG - Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
969664716 4:8550596-8550618 CTGTCAGAAAGAAAGAAGGGGGG - Intergenic
970146244 4:13039032-13039054 TTGTGAGACAGAGAGAAAGGAGG - Intergenic
970351764 4:15208568-15208590 CTATGAGAAAGCAATGAAGATGG - Intergenic
970380363 4:15501317-15501339 GTGTGAGATAGGAAGGAAAGGGG - Intronic
970497466 4:16641322-16641344 CAATGAGAAAGAAAGCAAAGGGG + Intronic
970589498 4:17546894-17546916 TGGTGAGAGAGAAAGCAAGGGGG - Intergenic
970935179 4:21561343-21561365 CTGATAGAAAGAAAAGAAAGAGG + Intronic
970961152 4:21872246-21872268 CTGTGAGAAAGAAGGTAGGTGGG - Intronic
971020037 4:22525576-22525598 CAGTGAGAAGCAAAGGAAAGAGG + Intergenic
971136548 4:23874818-23874840 CTAAGAGAAAGAAAGGGAGGAGG - Intronic
971181587 4:24333291-24333313 ATGTCAGAAAGAGAGGAAGATGG - Intergenic
971273463 4:25172899-25172921 CGGTGAGAAAGAGAGGGATGTGG + Intronic
971319673 4:25595264-25595286 CTTTTAGACAGAAAGGAGGGTGG + Intergenic
971460450 4:26890256-26890278 CTGGGAGAGAGAAGGGAATGTGG + Intronic
971469600 4:27007510-27007532 CTAGAAGAAGGAAAGGAAGGAGG - Intronic
971490364 4:27205800-27205822 CAGTGAGGCTGAAAGGAAGGAGG + Intergenic
971509232 4:27403460-27403482 CTGGGAGAAAGGATGGGAGGGGG + Intergenic
971540130 4:27805546-27805568 ATGAGAGAAATAAAGGAAAGAGG - Intergenic
971591788 4:28478250-28478272 CTGTAAGAAAGAAAGCTAAGTGG - Intergenic
971651315 4:29279044-29279066 GTGGAAGAAAGGAAGGAAGGAGG - Intergenic
971953772 4:33388906-33388928 AAGTGAGAAAGAAAGGAAAGAGG - Intergenic
972055530 4:34797205-34797227 AGGAAAGAAAGAAAGGAAGGAGG - Intergenic
972421393 4:38890514-38890536 CGGGCAGAAAGAAAGTAAGGAGG - Intronic
972429298 4:38964965-38964987 CTGTGAGAGGCAAAGGCAGGAGG - Intergenic
972693190 4:41419719-41419741 AGGGGAGGAAGAAAGGAAGGAGG - Intronic
972744088 4:41916380-41916402 CTTTGAGAAACCAAGGCAGGCGG - Intergenic
972790228 4:42364734-42364756 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
973063595 4:45761397-45761419 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
973254144 4:48092087-48092109 CTGAGAGAGAGAAAAGAAAGAGG + Intronic
973629876 4:52810484-52810506 TTGTGAGAAAGTAAGGTAAGTGG + Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
974142801 4:57909105-57909127 GTGTGAGAAGGAAGCGAAGGTGG - Intergenic
974157567 4:58093786-58093808 TTCTGAGAAAGAAAGGATGTGGG - Intergenic
974197241 4:58591440-58591462 CTGTGAGAAAGCAATCAGGGTGG + Intergenic
974289600 4:59913004-59913026 CTTGGAGAAAGAAGGGAGGGTGG - Intergenic
975009800 4:69336071-69336093 CTGTGAGGAGGAAAGGAACGTGG + Intronic
975616318 4:76251408-76251430 CTGAAGGAAAGAAAGGAAGAAGG - Intronic
975640292 4:76493604-76493626 GCGTGAGGAAGAAAGGAGGGAGG - Intronic
976116696 4:81735656-81735678 GTGGGAGCAAGAGAGGAAGGAGG + Intronic
976140220 4:81983788-81983810 CTGGAGGAAAGAAAGGAAAGAGG + Intronic
976455756 4:85245552-85245574 TTTTGAGGAAGAAAGGAAGGGGG - Intergenic
976554876 4:86438733-86438755 CTGTGTGAAAGAAATTGAGGGGG + Intronic
977227856 4:94414659-94414681 GGGAGAGAAAGAAAGGAAGTGGG - Intergenic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
977343583 4:95791141-95791163 CTGAGAGAGAGAAAGCCAGGTGG - Intergenic
977427761 4:96890830-96890852 TTGTTAGAAAGAAGGGAAGCTGG - Intergenic
977499182 4:97816844-97816866 GAAAGAGAAAGAAAGGAAGGAGG - Intronic
977551407 4:98447680-98447702 CTCTGAGGAAGAAAGGATTGGGG - Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978428228 4:108604476-108604498 CTTACAGAAAGAAAGGAGGGAGG + Intergenic
978731825 4:112037003-112037025 CTGTTAGAAAGTCACGAAGGAGG - Intergenic
978765094 4:112397018-112397040 CTTTGAGAAGCCAAGGAAGGAGG - Intronic
979113062 4:116783091-116783113 CTGTGGGACAGAAAGGAAAGAGG - Intergenic
979164752 4:117514698-117514720 CTGTGAAAAAGAAAGAAAACTGG + Intergenic
979979854 4:127241244-127241266 CTGTGGTCCAGAAAGGAAGGGGG + Intergenic
979986611 4:127324023-127324045 CGGTGAGAGAGAAAGTAAGAGGG - Intergenic
980078624 4:128320529-128320551 CAAGAAGAAAGAAAGGAAGGAGG - Intergenic
980535461 4:134115109-134115131 CTTTGGGAAAGAAAGGAAAGAGG - Intergenic
980968756 4:139549604-139549626 CTCTAAAAAATAAAGGAAGGAGG - Intronic
981242662 4:142496591-142496613 CTCTCACAAAGAAAGGAAAGAGG - Intronic
981417240 4:144507580-144507602 CTGTGAGGAAGAAAGAACAGTGG - Intergenic
981826845 4:148952792-148952814 CTTTGAGAAAGAAAAAAAGTAGG - Intergenic
981922643 4:150102304-150102326 CTATTTAAAAGAAAGGAAGGTGG + Intronic
982105432 4:152007988-152008010 CTGTGAGAAACAAATGTGGGTGG - Intergenic
982325688 4:154126408-154126430 ATGTGAGAAAGAAAGAAGGCAGG - Intergenic
982538805 4:156641327-156641349 CAAGAAGAAAGAAAGGAAGGGGG + Intronic
982660438 4:158200270-158200292 CGGTGAGAGAGAAAGCAAGGAGG - Intergenic
983481962 4:168285869-168285891 ATGGGAAGAAGAAAGGAAGGAGG + Intronic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
983671926 4:170247297-170247319 CTGTGAGAAAGGAAAGAAAGTGG - Intergenic
983747670 4:171221735-171221757 TTGTGAAAAGGAAAGAAAGGAGG - Intergenic
984073840 4:175150595-175150617 ATGTGAGACAGAAAGGGAAGGGG - Intergenic
984132203 4:175891691-175891713 CTGTAAGAGAGAAAAGAAGGTGG + Intronic
984168946 4:176338233-176338255 ATGTGTCAAAGAAATGAAGGAGG + Intergenic
984226742 4:177044405-177044427 TAGTGAGAAAGAAAGGACAGGGG - Intergenic
984362337 4:178750988-178751010 ATCTGAAAAAGAAAGGAAGTAGG - Intergenic
984486505 4:180376955-180376977 CTTTTAGAAAGAAATGTAGGTGG + Intergenic
984888341 4:184470914-184470936 CTGTCAGAAGGAAAGTTAGGTGG - Intronic
984959166 4:185077810-185077832 CTGAGAGAATGAAATGAAGCGGG - Intergenic
984970269 4:185182502-185182524 CTGTGAGAAATAGTGGAAGAAGG - Intronic
985220083 4:187695317-187695339 ATGGGTGAAAGAAAGAAAGGGGG + Intergenic
985311783 4:188609495-188609517 GAGCGAGAAAAAAAGGAAGGAGG + Intergenic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
985783955 5:1884687-1884709 AGGTGAGAAAGAAAGAAACGCGG - Intronic
985993693 5:3584582-3584604 ATGGGAGGAAGGAAGGAAGGAGG + Intergenic
985993767 5:3584889-3584911 ATGGGAGAAAGGAAGGAGGGAGG + Intergenic
985993802 5:3585033-3585055 ATGGGAGAAAGGAAGGAAGAAGG + Intergenic
986015192 5:3751521-3751543 AAGGGAGAAAGAAAGGATGGAGG + Intergenic
986380396 5:7179728-7179750 AAGTGAGATAGAGAGGAAGGTGG - Intergenic
986597023 5:9433612-9433634 GTGAGAGAAAGAGAGAAAGGAGG - Intronic
986598347 5:9446312-9446334 CTGAGGGAAAGAAAGAGAGGGGG + Intronic
986632435 5:9786837-9786859 ATGTGGGGAAGAATGGAAGGTGG - Intergenic
987201981 5:15586401-15586423 CTTTGGGAAAGAAAAGGAGGGGG - Intronic
987209821 5:15669555-15669577 GTGGGAGAAAGGAAGGTAGGAGG - Intronic
987263281 5:16225355-16225377 CTCAGCAAAAGAAAGGAAGGTGG + Intergenic
987382995 5:17303275-17303297 GGGTGAGAAAGAAAGGAGGAAGG - Intergenic
987460390 5:18202073-18202095 GAGTAAGAGAGAAAGGAAGGAGG - Intergenic
987566376 5:19593555-19593577 AAGTGGGAAAGAAAGGGAGGAGG - Intronic
988408279 5:30852693-30852715 CTCTGAGAAGGAAAGGAGGTGGG - Intergenic
988606868 5:32686153-32686175 GGGCAAGAAAGAAAGGAAGGAGG - Intergenic
988659724 5:33252244-33252266 GAGAGAGAAAGAAAGGAGGGAGG + Intergenic
988864509 5:35320294-35320316 CAGTCACAAAGAAAGAAAGGTGG - Intergenic
989138501 5:38179092-38179114 GGGTGAGGAAGAAAGGAAGAAGG + Intergenic
989334118 5:40294793-40294815 ATGTGAAAAATAAAGGTAGGAGG - Intergenic
989423817 5:41272623-41272645 TTGTTACAAAGAATGGAAGGGGG - Intergenic
989624092 5:43412921-43412943 TTAGGAGAAAGACAGGAAGGGGG + Intergenic
989691106 5:44145415-44145437 CAGTTAGAAACAAAGAAAGGAGG - Intergenic
990446283 5:55896819-55896841 CTGCCAAAAAGAAAGAAAGGCGG - Intronic
990494314 5:56332266-56332288 ATGTGAGAAAGAGAGGCAGAGGG + Intergenic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
990654455 5:57939651-57939673 AGGTAAGAAAGAAAGGAAAGAGG - Intergenic
991059003 5:62351350-62351372 TTATGAGAAAGAAAGGAATGGGG + Intronic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
991503181 5:67297909-67297931 CTGTGAGAGGGACAGGAATGTGG - Intergenic
991618263 5:68518641-68518663 CTGTTAGAAGGAAAGAAAGGAGG - Intergenic
991952101 5:71956388-71956410 CTGTAAGAAAGCTGGGAAGGGGG - Intergenic
992015744 5:72573637-72573659 GGGTGAGAAAGACAGAAAGGAGG - Intergenic
992170947 5:74101533-74101555 GTGTGAGAAAGAAAGGGAGAGGG + Intergenic
992362032 5:76048839-76048861 TTAGGTGAAAGAAAGGAAGGGGG + Intergenic
992564118 5:77981184-77981206 CGGTGAGACAGAAAGGAAGGTGG + Intergenic
992823882 5:80528271-80528293 CTAAAAGGAAGAAAGGAAGGGGG + Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993041729 5:82822314-82822336 CTGTGAGTTAGAAAGGGAAGAGG + Intergenic
993100532 5:83533410-83533432 CAGAGAGAGAGAGAGGAAGGGGG + Intronic
993386380 5:87267855-87267877 GGGAGAGAGAGAAAGGAAGGCGG - Intergenic
993477970 5:88388507-88388529 CAATGAGAAAGAAGGGAAGTGGG + Intergenic
993526590 5:88973248-88973270 ATGAAAGAAAGAAAGGAAAGGGG + Intergenic
993617329 5:90129709-90129731 CCTTGAGAAGGTAAGGAAGGAGG + Intergenic
994067014 5:95554855-95554877 CTTAGAGAAAGAAAGGATCGGGG - Intronic
994996048 5:107064368-107064390 GAGAGAGACAGAAAGGAAGGAGG + Intergenic
995313100 5:110735717-110735739 CTGGGAGACAGACAGCAAGGGGG - Intronic
995354634 5:111224135-111224157 CTGGGAGAGAGAAAGGAAAGAGG + Exonic
995512596 5:112923341-112923363 CTCTGAGGAAGAAAGGAGGAAGG - Intergenic
995798761 5:115968823-115968845 GTGTGACTGAGAAAGGAAGGAGG + Intronic
995865267 5:116683596-116683618 CTCTGGGAAAGCAAGGCAGGGGG + Intergenic
996154976 5:120087592-120087614 ATGAGACAAAAAAAGGAAGGAGG + Intergenic
996191655 5:120550748-120550770 CAATGAGAAAGGAAGGAATGAGG - Intronic
996211888 5:120820074-120820096 CTGAGAAAGAGAAGGGAAGGTGG + Intergenic
996221085 5:120934139-120934161 CTGTTATAAAGAAAGGAATCTGG - Intergenic
996496497 5:124162856-124162878 AAGGGAGCAAGAAAGGAAGGAGG + Intergenic
996594827 5:125188361-125188383 CTGAGAGAAAGAAAGGAACATGG - Intergenic
996665702 5:126057437-126057459 CTGTGACAAGGAAAAGAGGGCGG + Intergenic
996684953 5:126269777-126269799 CTGTGGGAGAGGAATGAAGGTGG + Intergenic
996985954 5:129564725-129564747 CTGTGGTACAGAAAGGAAAGGGG + Intronic
997083346 5:130766598-130766620 CAGTGAGAAAGTAAGGTAAGAGG - Intergenic
997293528 5:132754905-132754927 ATGGCAGAAAGAAAGGTAGGTGG + Intronic
997374287 5:133385692-133385714 CTGTAATTAAAAAAGGAAGGAGG - Intronic
998152853 5:139766997-139767019 CTCTGAGAAAGAAAGAAAGAAGG - Intergenic
998534110 5:142913400-142913422 GGGGGAGAAGGAAAGGAAGGAGG - Intronic
998651900 5:144130172-144130194 GAGAAAGAAAGAAAGGAAGGAGG + Intergenic
998651903 5:144130192-144130214 AGGAAAGAAAGAAAGGAAGGAGG + Intergenic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
998963715 5:147514498-147514520 CTCAAAGAAAGAAAAGAAGGAGG - Intergenic
998985920 5:147756635-147756657 CTGAGAGAAGAAAAGGAGGGTGG + Intronic
999349458 5:150854884-150854906 CTTTGAGAAAGAGAAGAAAGGGG - Intronic
999514203 5:152284642-152284664 CTGTGAGGCAGTAAGGAAGCAGG + Intergenic
999596624 5:153212259-153212281 GGGTAAGAAAGAAAGGAAGGAGG - Intergenic
999653711 5:153792689-153792711 CAGAAAGAAAGAAAGGAAGAAGG - Intronic
999655013 5:153802654-153802676 CCATGAGAAAGGAAGGAAGATGG + Intronic
999773865 5:154795465-154795487 GGGAGAGAAAGGAAGGAAGGAGG - Intronic
1000002215 5:157149802-157149824 CTGTAAGAAGTAAAGGAAAGAGG - Intronic
1000046145 5:157523531-157523553 AAGTGAGAGAGAAAGGGAGGAGG - Intronic
1000093078 5:157947074-157947096 CTCAGACAAAAAAAGGAAGGAGG - Intergenic
1000242761 5:159423752-159423774 CTGTGAGTAGGAAAGCGAGGTGG - Intergenic
1000789862 5:165592490-165592512 CTCTGCAAAAGAAAGGAAAGAGG + Intergenic
1000809108 5:165838549-165838571 GTGTGAGAGAGAAAGGGAGAAGG - Intergenic
1000826026 5:166044828-166044850 GTGTGAGACAGAGAAGAAGGAGG + Intergenic
1000864730 5:166499744-166499766 CTGTGGGAGAGAAAGAAAAGAGG + Intergenic
1000907928 5:166985929-166985951 ATGTTAGGAAGAAATGAAGGTGG + Intergenic
1001106201 5:168856840-168856862 CTCAGAGAAGGCAAGGAAGGAGG + Intronic
1001241014 5:170069857-170069879 CAGAGAGAAAGAGAGAAAGGAGG - Intronic
1001412939 5:171523747-171523769 CTCGGAGAAGGGAAGGAAGGAGG - Intergenic
1001560991 5:172668798-172668820 ATGGGAGAAGGAAAGGCAGGGGG + Intronic
1001575323 5:172759584-172759606 GAGAGAGAAAGAAAGGAGGGAGG + Intergenic
1001786545 5:174418784-174418806 GAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1001838462 5:174852810-174852832 CTGTGACAAAGAGAGGAAACTGG + Intergenic
1001919499 5:175588977-175588999 GAGGGAGAAAGAAAGGAAAGAGG + Intergenic
1002774762 6:319210-319232 GTGGGAGAAAGAAGGGAAGGGGG + Intronic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1002984111 6:2171370-2171392 CTGTGAGAAAGAAGAGAACTAGG - Intronic
1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG + Intronic
1003288991 6:4762027-4762049 CTGTGAGCAAGACCAGAAGGCGG + Intronic
1003663467 6:8087182-8087204 CTGAGAGAATGACGGGAAGGAGG + Intronic
1003994507 6:11525474-11525496 CTTTCAGAAGGGAAGGAAGGTGG + Intergenic
1004255307 6:14058050-14058072 CAGTTAAAAAGAAAGAAAGGGGG - Intergenic
1004295117 6:14403144-14403166 CAATGAAGAAGAAAGGAAGGAGG + Intergenic
1004296875 6:14420975-14420997 CTGTGGGAAAGCAAAGGAGGAGG - Intergenic
1004766634 6:18735984-18736006 CTCAGAGAAAGAAAAGAAGATGG + Intergenic
1004822903 6:19387478-19387500 AGTTAAGAAAGAAAGGAAGGGGG - Intergenic
1005224272 6:23623277-23623299 AAGAGAGAAAGAGAGGAAGGAGG + Intergenic
1005310694 6:24556199-24556221 ATGGAAGAAAGGAAGGAAGGAGG - Intronic
1005477217 6:26219548-26219570 TTGTGAGGAAAAAAGGGAGGGGG - Intergenic
1005645695 6:27836263-27836285 CTTGGTGAAAGAAAGGAAGCAGG + Intergenic
1005869626 6:29965120-29965142 GTGTGAGACAGAAAGGAAATGGG + Intergenic
1006090454 6:31625687-31625709 CTATGAGATAGAAGGGAGGGTGG + Intronic
1006567849 6:34974422-34974444 ATGAAAGAAAGAAAGGAAAGGGG - Intronic
1006703854 6:35999885-35999907 CTTTAAGATAGAAAGAAAGGAGG - Intronic
1006737146 6:36282175-36282197 CAGAGAGAAAGAAAGAAAGAAGG + Intronic
1006789726 6:36691975-36691997 ATGTGAGAAAGAAAAGGAGAAGG + Intergenic
1006865755 6:37207872-37207894 TTCTGAGCAAGAAAGGAAGCTGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008180269 6:48319667-48319689 CTGTGAGACAGAGAGAAAAGGGG + Intergenic
1008302983 6:49865557-49865579 TTGTGAAAACAAAAGGAAGGTGG + Intronic
1008609434 6:53172314-53172336 GTGTGAGAATGAACGGACGGCGG - Intergenic
1008717388 6:54305569-54305591 CTGGAAGGAAGAAAGGAAGATGG + Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009274664 6:61660312-61660334 CTCTGAGACAAAATGGAAGGAGG + Intergenic
1009338112 6:62519008-62519030 CCGTCAGAATGAAGGGAAGGAGG - Intergenic
1009659136 6:66587074-66587096 GAGAGAGAAAGAAAGGAAAGAGG - Intergenic
1009740699 6:67741375-67741397 GTATAGGAAAGAAAGGAAGGGGG + Intergenic
1009747012 6:67829449-67829471 CTGGGAAACAGAAATGAAGGAGG - Intergenic
1011656151 6:89553790-89553812 TTGTGAGGGAGAAAGTAAGGTGG - Intronic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1011888474 6:92127202-92127224 CTGTCAAAGAGAAGGGAAGGTGG - Intergenic
1012070394 6:94606207-94606229 CAGGGAGAAAGAATGGAAAGGGG + Intergenic
1012073889 6:94658491-94658513 AAGGGTGAAAGAAAGGAAGGAGG - Intergenic
1012672017 6:102064410-102064432 AAGAGAGAAAGAAAGAAAGGAGG - Intronic
1013169831 6:107626790-107626812 ATGTGAGAAAGAAAGGAAACTGG - Intronic
1013353910 6:109330967-109330989 CAGAGAGACAGAAAGGATGGTGG + Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013486748 6:110604042-110604064 GTGGGAGCAAGAAAGAAAGGAGG - Intergenic
1013582354 6:111548780-111548802 CTGTGGGATAGAAAGCAAGAAGG + Intergenic
1013609253 6:111778792-111778814 TTGTTAAAAAGAAAGTAAGGAGG - Intronic
1014310735 6:119798129-119798151 GAGAGAGAAAGAAAGGAGGGAGG - Intergenic
1014554947 6:122834410-122834432 GTGTTAAAAATAAAGGAAGGAGG + Intergenic
1014627755 6:123750359-123750381 GTTTGAGAAAGAAAGGAAGGAGG - Intergenic
1015015167 6:128404137-128404159 ATGTGAGAAAGAAAATATGGAGG - Intronic
1015387930 6:132647471-132647493 GAGAGAGAAAGAAAGGAAGAAGG + Intergenic
1015549382 6:134396140-134396162 ATAAAAGAAAGAAAGGAAGGAGG - Intergenic
1015858401 6:137650011-137650033 CAGTAACAAAGAATGGAAGGAGG + Intergenic
1015872440 6:137790748-137790770 ATGTGAAACAGAATGGAAGGTGG + Intergenic
1016066938 6:139693375-139693397 CTCTGAGAATGAAAGTAATGTGG + Intergenic
1016158667 6:140847404-140847426 TTGTAAGAAAAAAAGGAAGTTGG + Intergenic
1016844039 6:148553710-148553732 CTGTGAGAGAGAAAGGGAGGAGG + Intergenic
1017025800 6:150179412-150179434 GAGAGAGAAAGAAAGGAGGGAGG + Intronic
1017176977 6:151514318-151514340 ATGAAAGAAAGGAAGGAAGGAGG + Intronic
1017321144 6:153094705-153094727 ATGGGAGAAAGAATGGCAGGTGG + Intronic
1017334056 6:153234469-153234491 GGGAAAGAAAGAAAGGAAGGAGG + Intergenic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1017539098 6:155381699-155381721 ATTTTAAAAAGAAAGGAAGGAGG - Intergenic
1017595087 6:156019788-156019810 GTAAGAGAAAGAAAGGAAGAAGG - Intergenic
1018132758 6:160748300-160748322 ATGTGAGAAAGAAAGAAAGAAGG + Intronic
1018266924 6:162035126-162035148 CAGAGAGAAAGAGAGGAAAGGGG + Intronic
1018386389 6:163307873-163307895 GAGTGAGAAAGAAAAGAAAGAGG - Intronic
1019230789 6:170560456-170560478 CTGTCTCAAAGAAAGGAAGCAGG + Intronic
1019765207 7:2844544-2844566 CTTTCAGAATGAAAGGGAGGCGG + Intergenic
1019948968 7:4355519-4355541 GTGTGAGAGAGAATGGGAGGAGG - Intergenic
1020275280 7:6620593-6620615 GAGAGAGAAAGAAAGGAAGAAGG - Intronic
1020900070 7:13992391-13992413 GTGGGAGAAAGAAAAGAGGGTGG - Intergenic
1021292128 7:18858867-18858889 CTGTGAGTTAGAAGGGAAGTAGG - Intronic
1022009632 7:26297625-26297647 ATGTGAGGAAAGAAGGAAGGAGG - Intronic
1022140734 7:27491422-27491444 CTTGGAGAAGGAGAGGAAGGAGG + Intergenic
1022488420 7:30798341-30798363 CTGTGTTAGAGAAAGAAAGGAGG + Intronic
1022563618 7:31374714-31374736 AAGACAGAAAGAAAGGAAGGAGG + Intergenic
1022585366 7:31603720-31603742 CTGTGGGAGAGGAAGTAAGGTGG - Intronic
1022819858 7:33948868-33948890 CTGTGAGATAAGCAGGAAGGAGG + Intronic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023138804 7:37080692-37080714 CTTTGAGAAGGTGAGGAAGGTGG - Intronic
1023288776 7:38647041-38647063 AAGTGAGAAAGAGAGAAAGGAGG - Intergenic
1023370619 7:39508970-39508992 CTGTGAGAGAGACGGCAAGGGGG - Intergenic
1023438173 7:40159709-40159731 CTGAGAGATAGGAAGGCAGGAGG + Intronic
1023542501 7:41280748-41280770 CTATGAGGAAGTAAGGAAAGCGG - Intergenic
1023996574 7:45162341-45162363 GGGAGAGAAGGAAAGGAAGGTGG + Intronic
1024264797 7:47598318-47598340 CTGAGAGAAGGAAGGGAATGAGG + Intergenic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024458466 7:49635271-49635293 CAGAGAGAAAGAAAGGTAGAAGG + Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1024983316 7:55175328-55175350 CTGAGAGAAAGTACAGAAGGTGG - Intronic
1025111449 7:56220122-56220144 CAGAGAGAAAGAGAGGAAGGAGG + Intergenic
1025480908 7:60981686-60981708 ATGAGAGAAAGAAAGAAAGGAGG + Intergenic
1025488130 7:61077349-61077371 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1025556800 7:62319276-62319298 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1025605060 7:63033798-63033820 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1026226804 7:68449238-68449260 GAGGGAGAAAGAAAGAAAGGAGG - Intergenic
1026415168 7:70171924-70171946 CTCTGACCAAGAAAAGAAGGAGG - Intronic
1026474714 7:70725114-70725136 TTTTGAGAAAGAGAGCAAGGAGG + Intronic
1026521155 7:71119221-71119243 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1026552765 7:71381953-71381975 TTGTGGGAAAGAAAGGCAGAGGG + Intronic
1026571922 7:71538835-71538857 GAGGGAGAGAGAAAGGAAGGAGG + Intronic
1026598447 7:71753473-71753495 CAGAGAGAGAGAAAGGAAAGGGG - Intergenic
1027029828 7:74880018-74880040 AAGAGAGAGAGAAAGGAAGGAGG + Intergenic
1027590022 7:80106956-80106978 CTGATAGAGAGAAAGGAAGAGGG + Intergenic
1029495566 7:100894256-100894278 CTGGGAGAAAGAAAGGGAAAGGG + Intronic
1029766700 7:102630384-102630406 GAGGGAGAAAGAAAGGGAGGGGG - Intronic
1030114592 7:106053678-106053700 TTGCCAGAAAGAAGGGAAGGAGG - Intergenic
1030167973 7:106573580-106573602 CTCTAAGAGGGAAAGGAAGGAGG + Intergenic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030684412 7:112469840-112469862 CTGAGATGAAGAAAAGAAGGTGG - Intronic
1030804136 7:113893081-113893103 CTGTGTAAAAGAAAGGTAGTGGG - Intronic
1030832401 7:114241874-114241896 TTGGGGGAAAGAAAGGAAGCAGG - Intronic
1030874229 7:114793376-114793398 CTGTGAGGAAGAAAGGAACAAGG + Intergenic
1030921537 7:115395593-115395615 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1030932492 7:115542269-115542291 AAGTGAGAAAGAAAGGAAAGAGG + Intergenic
1031085735 7:117299960-117299982 CTGTTAGCAAGGAAGGGAGGAGG - Intronic
1031443873 7:121827027-121827049 AAGAGAGAAAGAAGGGAAGGGGG - Intergenic
1031551325 7:123116733-123116755 CTGTGTGAAAGAAAGGGAGCTGG + Intronic
1031606048 7:123769371-123769393 CTGTTAGAGAGAGGGGAAGGAGG + Intergenic
1031756142 7:125645408-125645430 CAGGGAGAAAGAGAGGGAGGGGG - Intergenic
1031986923 7:128169252-128169274 CTGTGAGAATGTCTGGAAGGGGG - Intergenic
1031991853 7:128203560-128203582 CTGTTAGGAGGAAAGGGAGGAGG - Intergenic
1032214885 7:129950293-129950315 TTGTCAGAAAGGAAGGAAGGTGG + Intronic
1032517623 7:132518833-132518855 CTGGGGGAGGGAAAGGAAGGAGG - Intronic
1032695501 7:134332576-134332598 CTGTGAGAGAGATAGGAAAAGGG - Intergenic
1032744960 7:134777156-134777178 ATTTAAAAAAGAAAGGAAGGGGG - Intronic
1032865417 7:135919606-135919628 CTGAGTGACAGAAGGGAAGGTGG - Intergenic
1033047843 7:137978692-137978714 CTGGGTGAATGAGAGGAAGGGGG + Intronic
1033108380 7:138552452-138552474 CTGTGAGAAATTAAGAAAGAAGG - Intronic
1033137079 7:138794471-138794493 ATGTGAAAAAGAAAAGAAGTAGG - Intronic
1033231571 7:139602462-139602484 ATGTCAAAACGAAAGGAAGGAGG + Intronic
1033246686 7:139722739-139722761 TTGTGAGAATGAAAGTAGGGAGG - Intronic
1033499349 7:141932138-141932160 CTGTGAGAATGAAGGGGAAGGGG + Intronic
1033534563 7:142299961-142299983 GAGAGAGAAAGAAAGGAGGGAGG - Intergenic
1033811111 7:145012193-145012215 CAGAGAGAAAGCAAGGGAGGAGG - Intergenic
1034021824 7:147652706-147652728 AAGTTAGAAAGGAAGGAAGGGGG + Intronic
1034257573 7:149733073-149733095 CTTCCAGAAAGGAAGGAAGGTGG - Intronic
1034307203 7:150053816-150053838 CAGTTACAAATAAAGGAAGGGGG + Intergenic
1034799644 7:154046867-154046889 CAGTTACAAATAAAGGAAGGGGG - Intronic
1035084831 7:156249176-156249198 CCATGAGTAAGGAAGGAAGGAGG + Intergenic
1035819405 8:2576379-2576401 CTGTGAGAAAGCATGAAAGACGG - Intergenic
1037172503 8:15909937-15909959 CTTTGAGAAGCAAAGGCAGGTGG - Intergenic
1037209837 8:16373366-16373388 GAGTGAGAAAGAAAAGAAGGAGG - Intronic
1037554706 8:20010996-20011018 CTGAAAGAAAGAAAGAAAGGTGG - Intergenic
1037855866 8:22370253-22370275 GTGTGAGCAGGTAAGGAAGGAGG - Intronic
1038205842 8:25464168-25464190 CTTTGAGAAGCAAAGGAGGGAGG + Intronic
1038228426 8:25678312-25678334 ATGAAAGAAAGAAAGGAAAGAGG - Intergenic
1038503941 8:28068124-28068146 AAGGAAGAAAGAAAGGAAGGAGG + Intronic
1038722832 8:30053165-30053187 CTGAGAGGATGAAACGAAGGGGG + Intergenic
1038806345 8:30795958-30795980 CAGAAAGAAAGGAAGGAAGGAGG + Intronic
1038955050 8:32458885-32458907 CAGTGAGATAGAAAGCCAGGAGG - Intronic
1039161590 8:34627595-34627617 CTGAGAAACAGCAAGGAAGGTGG - Intergenic
1039209101 8:35191346-35191368 CTTTGAGAAACAAAGGCGGGAGG - Intergenic
1039314536 8:36356734-36356756 CAGAGAGAAAGAAGGGAAGGAGG + Intergenic
1039727733 8:40238109-40238131 GGGAGAGAAAGAAAGGAAGGTGG - Intergenic
1039760720 8:40571559-40571581 CTGTGACAACGACAGGAATGAGG - Intronic
1040396935 8:47009359-47009381 CTGTCAGAAAAAAAAAAAGGAGG + Intergenic
1040447530 8:47510989-47511011 CTGTGAGAAACACAGGAGAGAGG + Intronic
1041032605 8:53753421-53753443 CAGGGAGAAAGAAAGGAACAGGG + Intronic
1041174596 8:55181445-55181467 CTGGAAGGATGAAAGGAAGGAGG - Intronic
1041182728 8:55265551-55265573 CTAAGAGTAAGAAAGGGAGGGGG + Intronic
1041213054 8:55572065-55572087 CTGTGAGCAAACAAGGAAGGGGG - Intergenic
1041548617 8:59075762-59075784 GAGAGAGAAAGCAAGGAAGGTGG + Intronic
1041700960 8:60788530-60788552 CTGTTAGCAGGAAAGGAAGAGGG - Intronic
1041935054 8:63324444-63324466 CTGAGAGAAGGAAGGGAATGAGG + Intergenic
1042029814 8:64463783-64463805 ATGTAAGAAAGTCAGGAAGGAGG + Intergenic
1042088048 8:65130206-65130228 CTGTGAGAAAAAAAAAAAGTCGG - Intergenic
1042366439 8:67942149-67942171 CTGTGAGAAAGAAACAATTGGGG + Intergenic
1042436530 8:68772798-68772820 CAGAAAGAAAGAAAGAAAGGAGG - Intronic
1042654866 8:71084988-71085010 CTCTGTCTAAGAAAGGAAGGAGG - Intergenic
1042947456 8:74169539-74169561 CACTGAGAAAGAAAAGAAAGAGG - Intergenic
1043404659 8:79918035-79918057 ATGTGAGACAGAAAGGAGTGAGG - Intergenic
1044144618 8:88696393-88696415 CAGTCAGAAACAAAGGAGGGAGG - Intergenic
1044357064 8:91234876-91234898 GAGAGAGAGAGAAAGGAAGGAGG - Intronic
1044451069 8:92336132-92336154 CAGTGAGAAGGAATGGATGGAGG + Intergenic
1044555232 8:93555945-93555967 GAGAGAGAAAGAGAGGAAGGGGG - Intergenic
1044822979 8:96170149-96170171 CTGGGAGAAAGAAGAGGAGGCGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045322577 8:101092909-101092931 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1045483082 8:102608656-102608678 GAGAGAGAGAGAAAGGAAGGAGG + Intergenic
1045523275 8:102921577-102921599 CTGTCAAAAAGAAGGGAAGGAGG - Intronic
1045836548 8:106528104-106528126 AAGGGAGAAAGAAAGGAAAGAGG - Intronic
1046097856 8:109581357-109581379 CTGTGAGGAAGGTAGGAAAGGGG - Intronic
1046528537 8:115413809-115413831 CAATGAGAAAGAATGGAAGATGG - Exonic
1046588447 8:116176351-116176373 GAGAGAGAAAGAAAGGAGGGAGG + Intergenic
1046756935 8:117981882-117981904 CAGGCAGAAAGAAAGAAAGGAGG + Intronic
1046987875 8:120410766-120410788 GAGAGAGAAAGGAAGGAAGGAGG - Intronic
1047023601 8:120804175-120804197 AAGAGAGAAAGAAAAGAAGGAGG - Intronic
1047256182 8:123215125-123215147 CTGTGAAAGAGAGAGGAGGGGGG + Intergenic
1047347255 8:124040244-124040266 CTGGGAGAAAAAGAGGAATGAGG + Intronic
1047435311 8:124831078-124831100 CTGGGAGACAGAAAAGAAGTGGG + Intergenic
1047626996 8:126666654-126666676 CAGCAAGAAAGAGAGGAAGGAGG + Intergenic
1047833847 8:128666271-128666293 TTATGAGTAAGAAAGGAAGGAGG + Intergenic
1048363141 8:133715262-133715284 AGGTAAGAAAGGAAGGAAGGAGG - Intergenic
1048407137 8:134135311-134135333 CTTGGAGGAAGAAAGGCAGGAGG - Intergenic
1048630661 8:136238880-136238902 CAATGACAATGAAAGGAAGGGGG - Intergenic
1048744164 8:137594605-137594627 CTGTTACAAAGAAAAAAAGGGGG + Intergenic
1048877614 8:138849403-138849425 TTTAGAGAAAGAAAGAAAGGGGG + Intronic
1049126044 8:140788908-140788930 ATGTGGGAAATAAAGGAAAGGGG - Intronic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1049830887 8:144700192-144700214 CTCTGGGACAGAAAAGAAGGCGG + Intergenic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1050011363 9:1188765-1188787 CCATCAGAAAGAAAGGAAGAAGG - Intergenic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050489359 9:6171848-6171870 GTGTGAGAAAGGAAAGAGGGAGG + Intergenic
1050685698 9:8166449-8166471 AGGGGAGAAAGAAGGGAAGGAGG + Intergenic
1050709729 9:8447811-8447833 ATGTGAAAAACAGAGGAAGGAGG + Intronic
1050762317 9:9087775-9087797 TTGTGAAAATGAAAGGAATGTGG - Intronic
1050931635 9:11335707-11335729 GTGAAACAAAGAAAGGAAGGAGG + Intergenic
1050948836 9:11562495-11562517 AAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1051014961 9:12463188-12463210 GAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1051024909 9:12596767-12596789 CTGGTAGAAAGAAAGAAAGATGG + Intergenic
1051559346 9:18422895-18422917 CTGTGAGAAAGAATGTTAGAGGG - Intergenic
1051792293 9:20819455-20819477 CTTTGAGAACGCAAGGCAGGAGG - Intronic
1052380846 9:27769102-27769124 AAGTGAGAAAGAAAAGAAAGAGG - Intergenic
1052859391 9:33427523-33427545 TGGGGAGAGAGAAAGGAAGGTGG + Intergenic
1053005162 9:34599423-34599445 TAGTGAAAAAGAAAGGGAGGAGG + Intergenic
1053173709 9:35907985-35908007 CTGGGAAATAGAAAGGAAAGAGG - Intergenic
1053203987 9:36171317-36171339 ATGAGAGAAAGAGAGGAAGATGG + Exonic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053385186 9:37681448-37681470 TTCTTAGAAAGGAAGGAAGGGGG - Intronic
1053415969 9:37946931-37946953 CTGTGAGAGGTAAAGGAAGCAGG - Intronic
1053540631 9:38970118-38970140 CATCAAGAAAGAAAGGAAGGAGG - Intergenic
1053698440 9:40661802-40661824 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054309731 9:63461209-63461231 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1054408520 9:64785351-64785373 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1054441673 9:65269162-65269184 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1054488607 9:65752327-65752349 AAGAGAGAAAGAAAGAAAGGAGG + Intergenic
1054625508 9:67393788-67393810 CATCAAGAAAGAAAGGAAGGAGG + Intergenic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1054944136 9:70776674-70776696 CTGTGGGAAAGAGAGAAATGTGG + Intronic
1055378535 9:75679675-75679697 ATGAGAGAAGGAAAGGAAAGAGG + Intergenic
1055705784 9:79001314-79001336 CTGTGGGAAAGAGAAGAAAGAGG - Intergenic
1055808778 9:80126720-80126742 CTTTGAGAAGCCAAGGAAGGAGG + Intergenic
1055856430 9:80693151-80693173 GTTTAAGAAAGGAAGGAAGGAGG - Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056807400 9:89739602-89739624 ATGAGAGAAAGAAAGGATGTGGG - Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057479529 9:95433827-95433849 CAGAGAGAAAGAAAGAAAAGAGG - Intergenic
1057755495 9:97831783-97831805 GTGGGAGACAGAGAGGAAGGGGG + Intergenic
1057939978 9:99273390-99273412 CTGTGAAATAGAAAGGAAAAAGG - Intergenic
1058171277 9:101684068-101684090 CAGGAAGAAGGAAAGGAAGGGGG - Intronic
1058553059 9:106136386-106136408 CTGTGAGAATGCATGGGAGGAGG - Intergenic
1059053605 9:110955006-110955028 CAGTAAGAAAGAAAGGAAAAAGG + Intronic
1059302559 9:113326469-113326491 CAGTCAGAAAGAAAGAAAGAAGG - Intronic
1059503508 9:114777204-114777226 GAGTGAGAGAGAAAGGAAGAAGG - Intergenic
1059724206 9:116990238-116990260 CTTTTAAGAAGAAAGGAAGGGGG - Intronic
1059736264 9:117102943-117102965 CTGTGAGAGAGACAGGGAGAGGG + Intronic
1059824302 9:118009798-118009820 CAGGGAGAAGGAGAGGAAGGAGG - Intergenic
1059933150 9:119281416-119281438 GTATGAGAAAGAAGGGAGGGAGG + Intronic
1060226314 9:121793176-121793198 ATGAGAGGAAGAAGGGAAGGAGG - Intergenic
1060229784 9:121818171-121818193 CTGTGAGATTGAATGGGAGGGGG + Intergenic
1060236003 9:121863041-121863063 CGGGAAGAAAGAAAGGGAGGAGG - Intronic
1060470519 9:123944276-123944298 AAGAGAGAAAGAAGGGAAGGAGG + Intergenic
1060586139 9:124787181-124787203 CTGTGAGAACGAGTGGAAGATGG + Exonic
1060760006 9:126238957-126238979 GTGTGAGAGAGAAATCAAGGAGG + Intergenic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1061365248 9:130169314-130169336 CTGAAAGAAAGAAAGAAAGAAGG - Intergenic
1061372219 9:130203772-130203794 TTGTGAGAATGAAATGAACGAGG - Intronic
1062199080 9:135291498-135291520 GTGTGAGAGATAAAGGAAGAAGG + Intergenic
1202780803 9_KI270717v1_random:34997-35019 AAGAGAGAAAGAAAGAAAGGAGG - Intergenic
1203461690 Un_GL000220v1:46692-46714 CTGTGTGGAAGAAAAGAATGTGG + Intergenic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185516588 X:703597-703619 CAGAGAGAGAGAAAGGAAGAGGG + Intergenic
1185517105 X:708297-708319 AAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1185556923 X:1028895-1028917 CTGTGAGGTAGGTAGGAAGGTGG + Intergenic
1185580717 X:1209769-1209791 TTTTGAGAAAGACAGTAAGGTGG - Intronic
1185708418 X:2282394-2282416 CAGAGAGAAAGAGAGAAAGGGGG + Intronic
1185803130 X:3031356-3031378 ATGTTAGAAAGGAAGGAAGGTGG - Intronic
1185843671 X:3417082-3417104 AAGGGAGAGAGAAAGGAAGGAGG - Intergenic
1185937746 X:4277872-4277894 GAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1185999240 X:4989412-4989434 GAGAAAGAAAGAAAGGAAGGAGG - Intergenic
1186013860 X:5168424-5168446 CTTTGAGAGGGAAAGGGAGGAGG - Intergenic
1186226004 X:7399840-7399862 CAGAGAGAAAGAGAGAAAGGAGG + Intergenic
1186655356 X:11605978-11606000 CTGTGAGAGAGGAAGCTAGGTGG + Intronic
1186779283 X:12897101-12897123 TTGTGAGAAGCATAGGAAGGAGG + Intergenic
1187149394 X:16668270-16668292 AAGAGAGAAAGAGAGGAAGGAGG + Intronic
1187155110 X:16714460-16714482 CTGTGACAAGGAAAGGGAGAAGG + Intergenic
1187512843 X:19937895-19937917 CTGTCAGCAAGAAGGGGAGGGGG - Intronic
1187765172 X:22633603-22633625 CTCTGGGAAAGAGAAGAAGGGGG + Intergenic
1187815664 X:23228965-23228987 CTGTGAGGAAGAAGGCAAAGGGG + Intergenic
1188163229 X:26828237-26828259 ATGAGAGGAAGAAAGGAAGGAGG - Intergenic
1188491241 X:30740775-30740797 CTGGCAAAAAGAAGGGAAGGTGG - Intergenic
1188582758 X:31735284-31735306 CTATGTGAAAGAAAAGAAGGAGG - Intronic
1188958569 X:36463519-36463541 CTGGGAGCAGGAAAGGGAGGAGG + Intergenic
1189658188 X:43268824-43268846 CTGTGAGCAACAAAGGGAAGAGG + Intergenic
1189772441 X:44439875-44439897 AAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1190397417 X:49999013-49999035 CTGGGTGAAAAAAAGCAAGGGGG - Intronic
1192680233 X:73245818-73245840 TTTTGAGAAATAAAGGAGGGAGG + Intergenic
1192985991 X:76398816-76398838 CGGTTAGAAAGAAAGAATGGGGG + Intergenic
1193245440 X:79223331-79223353 CTGTCTGAAAGAAAGAAAGAAGG + Intergenic
1193369136 X:80672376-80672398 AGGTGAGGAAGGAAGGAAGGAGG + Exonic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193533105 X:82680325-82680347 GAGAGAGAAAGAAAGGAGGGAGG - Intergenic
1193533128 X:82680400-82680422 GAATGGGAAAGAAAGGAAGGAGG - Intergenic
1194000068 X:88417262-88417284 CAGAAGGAAAGAAAGGAAGGAGG + Intergenic
1194046018 X:89004243-89004265 CTGAGAGACAGAAAGGCAGAAGG + Intergenic
1194460019 X:94154610-94154632 CGGAAAGAAAGAAAGGAGGGAGG - Intergenic
1195380958 X:104270410-104270432 CTGTGAGATAGAAAGGCAGATGG - Intergenic
1195423091 X:104697345-104697367 CTGTGAAACAGAACTGAAGGAGG - Intronic
1195449962 X:105000063-105000085 CTTTGAGAAGGAAATGAAAGAGG - Intronic
1195701178 X:107706917-107706939 GTGTTACAAAGAAAGGAAGAAGG + Intergenic
1195925128 X:110017398-110017420 AAGAAAGAAAGAAAGGAAGGAGG - Intronic
1196203986 X:112918337-112918359 CTGTAGGAAAGAGAGGGAGGGGG - Intergenic
1196581508 X:117384589-117384611 GTGAGAAAAAGAAAGGCAGGAGG - Intergenic
1196729100 X:118923036-118923058 GAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1196754022 X:119142476-119142498 CATGGTGAAAGAAAGGAAGGAGG + Intronic
1196770885 X:119292234-119292256 GAGTGAGAAAGAGAGGAAAGGGG + Intergenic
1196830093 X:119768979-119769001 TTGTCAGAATGAAGGGAAGGAGG - Intergenic
1196834554 X:119802243-119802265 CAAGAAGAAAGAAAGGAAGGAGG - Intergenic
1198110029 X:133494781-133494803 GAGAGAGAGAGAAAGGAAGGAGG - Intergenic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1198404990 X:136303477-136303499 CAGACAGAAAGAAAGAAAGGAGG + Intronic
1198404992 X:136303481-136303503 CAGAAAGAAAGAAAGGAGGGAGG + Intronic
1198531761 X:137555062-137555084 AAGAAAGAAAGAAAGGAAGGAGG + Intergenic
1198757459 X:139996316-139996338 CTGTGTGAAAGGAAATAAGGAGG - Intergenic
1198783009 X:140257536-140257558 CTGGGGGAGAGAAAGCAAGGTGG + Intergenic
1198790723 X:140342639-140342661 CTGTGAGAAAGAACAGCAAGAGG + Intergenic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1199179662 X:144838606-144838628 AAGGGAAAAAGAAAGGAAGGAGG - Intergenic
1199433427 X:147786249-147786271 ATGAAAGAAAGAAAGAAAGGGGG - Intergenic
1199717731 X:150518260-150518282 CAGAGAGAAAGAAAGCAAGAAGG + Intergenic
1199903388 X:152199817-152199839 ATGTGAGACAGAAAGGAGGGAGG - Intronic
1199930056 X:152508818-152508840 TTGTGTGAAAGCAAGGGAGGTGG + Intergenic
1199934663 X:152560752-152560774 ATGTGAGGAAGCAAGGTAGGAGG + Intergenic
1200238053 X:154478656-154478678 CGGGGAGAAGGAAAGGAGGGCGG - Intronic
1200279179 X:154762534-154762556 GTGTGAGAAAGCAAAGAAAGAGG + Intergenic
1200576053 Y:4890960-4890982 TTGGGAGAAAGTAAGGAAAGAGG - Intergenic
1200738876 Y:6831571-6831593 CAGGAAGAAAGGAAGGAAGGAGG - Intergenic
1200807040 Y:7443588-7443610 GAGAGAGAGAGAAAGGAAGGAGG - Intergenic
1201237312 Y:11923619-11923641 CTTCGAGAAAGACAGGAAGAAGG - Intergenic
1201256370 Y:12112085-12112107 GAGAGAGAAAGAAAGAAAGGGGG - Intergenic
1201505583 Y:14695947-14695969 CTGACAGAGAGAAAGGAAAGGGG - Intronic
1201540088 Y:15096610-15096632 GAGAGAGAAAGAAAGGAAGAGGG - Intergenic
1201625703 Y:16012232-16012254 AGGTGAGGAAGAAAGGAGGGAGG + Intergenic
1201690525 Y:16759864-16759886 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1201934246 Y:19388783-19388805 CAGCAAGAAAGAAAGAAAGGGGG - Intergenic