ID: 977918964

View in Genome Browser
Species Human (GRCh38)
Location 4:102623284-102623306
Sequence GTAACCTGGTTGTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977918964_977918967 -7 Left 977918964 4:102623284-102623306 CCAGTAGCAGACAACCAGGTTAC No data
Right 977918967 4:102623300-102623322 AGGTTACTAGGTCTGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977918964 Original CRISPR GTAACCTGGTTGTCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr