ID: 977919031

View in Genome Browser
Species Human (GRCh38)
Location 4:102623904-102623926
Sequence TTCATTTGTTGAGGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977919031_977919037 24 Left 977919031 4:102623904-102623926 CCAGCATTCCCTCAACAAATGAA No data
Right 977919037 4:102623951-102623973 TGGCACCGGTCCCCAAGAACAGG No data
977919031_977919039 30 Left 977919031 4:102623904-102623926 CCAGCATTCCCTCAACAAATGAA No data
Right 977919039 4:102623957-102623979 CGGTCCCCAAGAACAGGCCCAGG No data
977919031_977919036 10 Left 977919031 4:102623904-102623926 CCAGCATTCCCTCAACAAATGAA No data
Right 977919036 4:102623937-102623959 GCACACATGATGCTTGGCACCGG No data
977919031_977919034 4 Left 977919031 4:102623904-102623926 CCAGCATTCCCTCAACAAATGAA No data
Right 977919034 4:102623931-102623953 GCTCCAGCACACATGATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977919031 Original CRISPR TTCATTTGTTGAGGGAATGC TGG (reversed) Intergenic
No off target data available for this crispr