ID: 977920600

View in Genome Browser
Species Human (GRCh38)
Location 4:102638454-102638476
Sequence CAAGACACTCAAACTCTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977920600_977920607 26 Left 977920600 4:102638454-102638476 CCACTTAGAGTTTGAGTGTCTTG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 977920607 4:102638503-102638525 GAACTCAGGAATAATCTGCATGG 0: 1
1: 0
2: 2
3: 13
4: 165
977920600_977920608 27 Left 977920600 4:102638454-102638476 CCACTTAGAGTTTGAGTGTCTTG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 977920608 4:102638504-102638526 AACTCAGGAATAATCTGCATGGG 0: 1
1: 0
2: 0
3: 18
4: 142
977920600_977920605 12 Left 977920600 4:102638454-102638476 CCACTTAGAGTTTGAGTGTCTTG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 977920605 4:102638489-102638511 CTACTCTTCCTGAGGAACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 136
977920600_977920603 4 Left 977920600 4:102638454-102638476 CCACTTAGAGTTTGAGTGTCTTG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 977920603 4:102638481-102638503 CCACAGACCTACTCTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977920600 Original CRISPR CAAGACACTCAAACTCTAAG TGG (reversed) Intronic
902037960 1:13471286-13471308 TAAGCCACTCAAACTGTATGAGG - Intergenic
903706828 1:25292067-25292089 GAAGAAACTAAAGCTCTAAGAGG - Intronic
903720405 1:25401274-25401296 GAAGAAACTAAAGCTCTAAGAGG + Intronic
906591485 1:47028968-47028990 CAAGACTCTCAACCTTTCAGTGG + Intronic
907955639 1:59225575-59225597 CAAGAGACTAAAGCTCTAAGAGG - Intergenic
909894854 1:81055211-81055233 CTAGAAACTAAAACCCTAAGTGG + Intergenic
915076386 1:153311389-153311411 CAAGTGACTCAAACTCTCTGAGG - Intergenic
917361828 1:174184948-174184970 GAAGATGCTCAACCTCTAAGTGG + Intronic
918766506 1:188491994-188492016 CAAGACACTGAAACTGCAAAGGG + Intergenic
919651207 1:200150444-200150466 CAAGAAGCTCTAATTCTAAGTGG - Intronic
920357093 1:205381913-205381935 CAAGACCCACACACTTTAAGGGG - Intronic
921519471 1:216141653-216141675 CAAGCCACTCAAAGTCTAAAGGG - Intronic
922518899 1:226229100-226229122 CAGCTCTCTCAAACTCTAAGAGG + Intergenic
924638474 1:245810673-245810695 CTAGACACATAAGCTCTAAGAGG - Intronic
1065016017 10:21463532-21463554 CAAGACATTCAAGCTGGAAGTGG + Intergenic
1066124457 10:32326488-32326510 CAAGAACCTCAAAATCTTAGTGG - Intronic
1067167612 10:43878123-43878145 CAAGACCCTCAGGATCTAAGTGG - Intergenic
1068441317 10:57058336-57058358 CCAGACAGTCAAACTCTCAAAGG - Intergenic
1068471913 10:57476210-57476232 AAAGACCATCAAACTCTCAGTGG + Intergenic
1070443391 10:76468843-76468865 CAAGGCACTAAAACATTAAGAGG + Intronic
1073456489 10:103639924-103639946 CAAGACACTTACATTCTCAGAGG + Intronic
1074831547 10:117253224-117253246 CAAGACAGTCAAACACAAAAAGG + Intronic
1076307149 10:129473481-129473503 CAAGTCACTCAAACTCTCCGAGG - Intronic
1077596134 11:3533274-3533296 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1078067394 11:8087369-8087391 CAAGCCACTCACACTTTCAGAGG - Intronic
1078926619 11:15880941-15880963 CAAGACTCTGAGACTCTTAGAGG - Intergenic
1079026198 11:16949925-16949947 CAAGAAAGTCAAACTCTACAAGG + Intronic
1080947584 11:36991985-36992007 GAAGACACTGAAACACGAAGAGG - Intergenic
1082073127 11:47955624-47955646 AAAGAAACTGAAACTCAAAGAGG + Intergenic
1083425990 11:62586304-62586326 TAAGAAACTGAAACTCAAAGAGG + Intronic
1084252041 11:67907262-67907284 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1084970981 11:72771935-72771957 CAAGACAGGCAAACACAAAGAGG + Intronic
1086247148 11:84767107-84767129 AAATACACTCAAACTCTGAGAGG - Intronic
1087403573 11:97699727-97699749 CAAGTCACTCAAACTTTATGTGG + Intergenic
1090427933 11:126622751-126622773 CTAGGAACTCAAACTCTAAAAGG + Intronic
1093304521 12:17497336-17497358 TAAGAAATTCAAACTTTAAGCGG - Intergenic
1093334423 12:17884650-17884672 CAATAGGCTTAAACTCTAAGTGG + Intergenic
1094607550 12:31961857-31961879 CAAGACACTGATAATCTAGGAGG - Intronic
1095187686 12:39220555-39220577 CAAGACACTCTTCCTGTAAGTGG + Intergenic
1095807299 12:46333724-46333746 CAAAACACTCCAAATCTCAGTGG - Intergenic
1096172177 12:49480500-49480522 CTAGACAGTAAAACTCTAAGAGG + Intronic
1102729276 12:115093746-115093768 CAAGACACAAAAACTTAAAGTGG + Intergenic
1103866996 12:124060698-124060720 CAAGTTTCTAAAACTCTAAGAGG - Intronic
1107731439 13:43352979-43353001 CAAGACACCTAAACTCTTTGAGG + Intronic
1107837082 13:44420920-44420942 CAAGTCACTCAGCCTCGAAGTGG - Intergenic
1108423208 13:50271579-50271601 ACAGACACACAAACTCTATGGGG - Intronic
1108424430 13:50284616-50284638 CAAGACGCTCATAGTCTAAAAGG - Intronic
1108485623 13:50921191-50921213 CAAGATACTCAACCTCTCTGTGG - Intronic
1109738521 13:66519601-66519623 TATGACACTCACATTCTAAGAGG - Intronic
1112243951 13:97711190-97711212 CAAGCCACTCAAAATCTCAGTGG - Intergenic
1115936250 14:38556547-38556569 CAAGTCACTTAAGGTCTAAGAGG + Intergenic
1117820441 14:59644056-59644078 AAAGACACAGAAACTCTAAAAGG + Intronic
1119382063 14:74235513-74235535 TAAGACACTAAAGCTCCAAGAGG - Intergenic
1121466819 14:94121049-94121071 CAAGATAGTCACACTCTAGGAGG - Intergenic
1124057630 15:26256759-26256781 CAATAAACTCAAATTATAAGAGG + Intergenic
1127638893 15:60896842-60896864 CAAGTCACTTAACCTCTAAGAGG + Intronic
1128729489 15:70011110-70011132 CAAGCCATCCAAACTCTCAGAGG + Intergenic
1132064731 15:98721460-98721482 CAAACCACTCAGACACTAAGTGG - Intronic
1133375974 16:5287528-5287550 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1134773505 16:16831597-16831619 CAAGACTCTGAAACCCAAAGAGG - Intergenic
1140268512 16:73441777-73441799 CAAGACACTGAGACTCAGAGAGG - Intergenic
1140336722 16:74113987-74114009 CAAGGCACTCAGATTCTGAGAGG + Intergenic
1140766110 16:78158976-78158998 TAAGACACTCAAACTCATAGAGG - Intronic
1143721025 17:8809790-8809812 AAAGACATTTACACTCTAAGGGG + Intronic
1143722714 17:8823869-8823891 CAAGTTATTCAAACTCTATGAGG + Intronic
1143790456 17:9291054-9291076 CAACACACACAAACTCTATTTGG - Intronic
1146814255 17:35929908-35929930 GAAGAAACTCAAACTCAAGGTGG - Intronic
1148279924 17:46339857-46339879 CAGGACACTCCAAGTGTAAGTGG - Intronic
1148302142 17:46557713-46557735 CAGGACACTCCAAGTGTAAGTGG - Intronic
1152346926 17:79758426-79758448 CCAGAGACTCAAACTACAAGTGG + Intergenic
1153982525 18:10322268-10322290 CAAGACCCTGAGACTCTGAGAGG - Intergenic
1166353536 19:42213221-42213243 AGTGACACTCAAACTCAAAGGGG + Intronic
1167573799 19:50307749-50307771 GAAGAAACTGAAACTTTAAGAGG + Intronic
928352665 2:30574597-30574619 CAAAACACTCAGACTCTATATGG + Intronic
930658530 2:54030985-54031007 CAAGAAACTCATCCTCTAGGAGG + Intronic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932281482 2:70496598-70496620 CAAGTCACTGAAACTCTCTGGGG + Intronic
937572108 2:123376641-123376663 GAAGACATACAACCTCTAAGGGG + Intergenic
941257080 2:163245666-163245688 CAAGAAACTGACAATCTAAGTGG - Intergenic
941718935 2:168792908-168792930 CAGGAAACTGAAACTCAAAGGGG + Intronic
943075825 2:183193305-183193327 CAAGACAGTCAAAATCATAGTGG - Intergenic
945187926 2:207158348-207158370 GAAGAAACTCAACCTCTGAGAGG - Intronic
945685537 2:212964965-212964987 CAAGATACTCAAACTACAAATGG + Intergenic
946043902 2:216805028-216805050 AAAGACACTGAAACTCAGAGGGG - Intergenic
946078861 2:217099199-217099221 AAAGAAATTCAAACTCTCAGTGG - Intergenic
1169537125 20:6557092-6557114 CAGGACAGTTAAACTCTAATGGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171454066 20:25257001-25257023 CAAGTCACTCAGCCTCTGAGAGG - Intronic
1172348081 20:34220232-34220254 CATGAAACTCAAAGTCTAAGGGG + Intronic
1173320493 20:41983193-41983215 CAGGAAACTCAAAGTCTAAAGGG - Intergenic
1173520290 20:43694953-43694975 CCAGACACTCAAAGTGTCAGGGG - Intronic
1174961470 20:55161904-55161926 CAAGACACTCATATTGTAATGGG - Intergenic
1175326257 20:58130382-58130404 CAGGACACTCAGACTCAGAGAGG - Intergenic
1179128880 21:38616691-38616713 GAAAACATTCAACCTCTAAGAGG + Intronic
1182948799 22:34351683-34351705 ACAGACACTCAAAGGCTAAGTGG + Intergenic
1183773849 22:39949665-39949687 GAAGACACTAAAGCTCAAAGGGG - Intronic
1185170355 22:49290205-49290227 CCAGACACTCACACTCTGAAAGG - Intergenic
949506241 3:4730731-4730753 CAAGTCACTCTAGCTCCAAGTGG + Intronic
952425922 3:33174359-33174381 CAAGACATTCAGACTCTTATGGG - Intronic
953385607 3:42504186-42504208 CAAGCCACTCAAACTCTTCTTGG + Intronic
954622456 3:52003885-52003907 CAAGTCACTCAACTTCTCAGAGG + Intergenic
955087447 3:55717008-55717030 CTACACACTCAAAATCTCAGGGG - Intronic
955651499 3:61199077-61199099 CAGGAAACTGAGACTCTAAGAGG + Intronic
956122268 3:65978276-65978298 CAAGACACACAACCACTAAATGG + Intronic
956796129 3:72720334-72720356 CAAGTCACTCGACCTCTGAGGGG + Intergenic
959313137 3:104766746-104766768 CAAGATACACAAGCTATAAGAGG + Intergenic
959481276 3:106875466-106875488 AAAGTCACTCAATCTCTCAGTGG - Intergenic
960506882 3:118504681-118504703 CAAGACCCTCTACCTCTAACTGG + Intergenic
960854870 3:122092565-122092587 GAAGAAACTGAAACTCAAAGTGG - Intronic
961058286 3:123807519-123807541 CATGACAATAAAAATCTAAGGGG - Intronic
961287046 3:125814403-125814425 CAAGTCACTCCAAATCTCAGTGG + Intergenic
963102232 3:141618798-141618820 AAAGACACACAAACCCAAAGAGG - Intergenic
963814809 3:149817662-149817684 GAAGACACTCAAAGGATAAGAGG + Intronic
964961216 3:162428868-162428890 CAAGGCATTCAAATTCTAAAAGG + Intergenic
966042251 3:175506087-175506109 CAAGACACTAAAATTATGAGCGG + Intronic
966273443 3:178136484-178136506 CAAGTGACTCAAACTCTCTGAGG - Intergenic
969010705 4:4059737-4059759 CAAGTCACTCCAAATCTCAGTGG - Intergenic
969686901 4:8680657-8680679 CAACACACACACACTCAAAGTGG - Intergenic
969802745 4:9582255-9582277 CAAGTCACTCCAAATCTCAGTGG + Intergenic
970161188 4:13190992-13191014 CAAGACAGCCAAAATGTAAGTGG + Intergenic
971231722 4:24805544-24805566 CTAGACATTCAGACTCTAAAAGG - Intergenic
974172442 4:58283132-58283154 CAAAACACTCAAGCTCTCATTGG + Intergenic
976709261 4:88051662-88051684 TAACAGACTCAAACTCAAAGAGG - Intronic
977779447 4:100963320-100963342 AAAGACACTGAAACTCAGAGAGG - Intergenic
977920600 4:102638454-102638476 CAAGACACTCAAACTCTAAGTGG - Intronic
978306771 4:107337115-107337137 CAAGACAAGCAAATGCTAAGGGG - Intergenic
982751834 4:159171409-159171431 CAAGTCACTCAACCTCTCTGTGG - Intronic
984104609 4:175529488-175529510 CAAGATGCTCATACTCTAGGGGG - Intergenic
984895564 4:184536752-184536774 CAAGAAACTAAGACTCAAAGAGG + Intergenic
988698189 5:33645190-33645212 GAAGGCACTCAAGCTATAAGGGG + Intronic
992017082 5:72586421-72586443 CAAGAAACTTATACTCTAACTGG - Intergenic
992238838 5:74743665-74743687 CAACACAAACAAACTCAAAGAGG + Intronic
993368745 5:87065365-87065387 CATTTCACTCAAACTCTTAGAGG + Intergenic
1000746147 5:165036420-165036442 CAACACAGTCAAACTTTAAGGGG + Intergenic
1001160879 5:169311603-169311625 CAAGAGACTCACAGTCTAACTGG - Intergenic
1001267420 5:170284002-170284024 CAGGACACTCACATTCTAAAGGG - Intronic
1001991014 5:176115365-176115387 CATGACACTCACACTCTCTGTGG + Intronic
1002225858 5:177722775-177722797 CATGACACTCACACTCTCTGTGG - Intronic
1002267989 5:178048437-178048459 CATGACACTCACACTCTCTGTGG + Intronic
1003374316 6:5561296-5561318 GAAGAAAAGCAAACTCTAAGAGG - Intronic
1003690980 6:8353503-8353525 CATGAAAGTCAAACACTAAGAGG + Intergenic
1004150421 6:13114283-13114305 CCAGAGACTGAAACTCTGAGAGG - Intronic
1004227398 6:13798945-13798967 TAAGAAACCCAAACTCTATGAGG + Intronic
1006773922 6:36577276-36577298 CAAGGGACTCAGAATCTAAGTGG + Intergenic
1007240226 6:40419571-40419593 AAAGAACCTCAAACTCTAGGTGG - Intronic
1007294870 6:40814080-40814102 AAAAACACTCAACCTCTAACTGG - Intergenic
1010377792 6:75193170-75193192 CAAGACACTCAGACTCTGCCAGG + Intronic
1011497910 6:87954343-87954365 GAAGACACTGAGACTCTGAGTGG + Intergenic
1013573580 6:111455044-111455066 CATGAAACGCACACTCTAAGAGG + Intronic
1015466055 6:133549862-133549884 CAAGAGCAACAAACTCTAAGTGG - Intergenic
1016195275 6:141328601-141328623 CAAAACAATCAAACTCATAGAGG + Intergenic
1016683935 6:146860565-146860587 CAAAACATTCAAAGTCTAAAGGG + Intergenic
1019026309 6:168966696-168966718 CAAGACACTGAAGCCCCAAGGGG - Intergenic
1020597797 7:10231142-10231164 GAAGAAACTCAAAATATAAGTGG + Intergenic
1021508749 7:21412687-21412709 CAAGATACTCAACCTCTTTGGGG + Intergenic
1024709016 7:51995036-51995058 CAATACAGTCAAACTCTCAAGGG - Intergenic
1024874414 7:54005425-54005447 CAAGCAACTCAAAATCTCAGTGG - Intergenic
1027427972 7:78081257-78081279 GAAGACACTCAAAACCTAGGAGG - Intronic
1027806616 7:82833473-82833495 CAATATACTCAAACTTTGAGGGG - Intronic
1029069993 7:97887741-97887763 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1031085149 7:117295238-117295260 GAGGACACTGAAGCTCTAAGAGG - Intronic
1031175731 7:118346755-118346777 CAAGACATTCAAACATTCAGTGG - Intergenic
1031530154 7:122866361-122866383 CAAGACTGTACAACTCTAAGAGG + Intronic
1031709343 7:125025342-125025364 AAATAGACTCAAACTCTAAATGG - Intergenic
1031762309 7:125729021-125729043 CAAGACATTCTAGCTATAAGTGG - Intergenic
1032506447 7:132438233-132438255 GAGGACACTGAAGCTCTAAGTGG - Intronic
1035626753 8:1076697-1076719 CAGGACACTAACACACTAAGGGG - Intergenic
1036248563 8:7141949-7141971 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1036252249 8:7172395-7172417 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1036365243 8:8115065-8115087 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1036428504 8:8667988-8668010 AAAGACAGTAAAACTCTGAGAGG - Intergenic
1036885685 8:12551047-12551069 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG + Intergenic
1044820150 8:96150583-96150605 GAAGAAACTAAAGCTCTAAGAGG + Intronic
1044991050 8:97796099-97796121 CAAAACACACAAAAACTAAGCGG - Intronic
1046437282 8:114207676-114207698 CAAGAAACTCAAAATATATGGGG + Intergenic
1047142482 8:122156646-122156668 CAAAACCCTCAAAAACTAAGAGG - Intergenic
1047725637 8:127681687-127681709 GAAGACACTGAAACTTTGAGTGG - Intergenic
1050213040 9:3286278-3286300 CAACTCACACAAACTCTATGAGG + Intronic
1052975285 9:34405658-34405680 CAGGAGCCTGAAACTCTAAGAGG - Intronic
1055464460 9:76550407-76550429 CAAGACAGCCAGACTCTAGGAGG - Intergenic
1059787233 9:117598848-117598870 TCAGCAACTCAAACTCTAAGGGG - Intergenic
1187888332 X:23909801-23909823 CAAGTCACTTAACCTCTCAGTGG - Intronic
1189155190 X:38749834-38749856 CAGGACACTCAGCCTTTAAGGGG + Intergenic
1189183891 X:39034588-39034610 AAAGACACACCAACTCTAAATGG - Intergenic
1189536851 X:41944180-41944202 TAAGAAACTGAGACTCTAAGTGG - Intergenic
1190468660 X:50752995-50753017 CAAGACACTCCATCTCTCAGAGG - Intronic
1198149883 X:133897823-133897845 CCAGACATTGAAACACTAAGTGG + Intronic
1200324000 X:155218342-155218364 AAAGAAACTCAAGCTCAAAGTGG - Intronic
1201470702 Y:14331546-14331568 GAAGACACTTAAACTCTACAGGG + Intergenic