ID: 977922190

View in Genome Browser
Species Human (GRCh38)
Location 4:102658033-102658055
Sequence TGGTTGTTGAATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977922190 Original CRISPR TGGTTGTTGAATAGGGAAGA AGG (reversed) Intronic
902373523 1:16019411-16019433 TGCCAGTTGGATAGGGAAGAAGG - Intronic
905303211 1:36999496-36999518 TGGGTGGTGAGTAGGGGAGATGG - Intronic
906575208 1:46883088-46883110 GGGTACTGGAATAGGGAAGATGG + Intergenic
906596766 1:47084806-47084828 GGGTACTGGAATAGGGAAGATGG - Exonic
908652480 1:66351050-66351072 TATTTTTTGAAAAGGGAAGAAGG - Intronic
911291994 1:96068030-96068052 TGGGTGTTGAGTGGGGAAAATGG - Intergenic
911366030 1:96938472-96938494 TGCTTGTTTAATAGGGTACATGG - Intergenic
912255077 1:108050057-108050079 TGGTTGTTGAAGCTGGATGATGG + Intergenic
915758339 1:158285766-158285788 TGGCTGTTGCAGAGGGCAGAGGG + Intergenic
918194865 1:182211891-182211913 CGATTGTTGAATGGTGAAGATGG + Intergenic
918989083 1:191674661-191674683 TGGTGGGTGAGTAGGGATGAGGG - Intergenic
919058458 1:192600368-192600390 TGGTTATTCAAGAGGTAAGAAGG + Intergenic
921275296 1:213513089-213513111 AGGTTCTTAAATATGGAAGAGGG + Intergenic
921931101 1:220754951-220754973 TGGCTGGTGATTAAGGAAGATGG + Exonic
924281073 1:242438059-242438081 TGGTTGCAAAATAGTGAAGAGGG + Intronic
1064467937 10:15603800-15603822 TCGTTATTGGTTAGGGAAGAAGG - Intronic
1064818866 10:19300684-19300706 TGGTTTTTGAATATGGAGTAAGG - Intronic
1065667301 10:28075877-28075899 CCGTTGTTGAATAAGGCAGAAGG - Intronic
1065998894 10:31085978-31086000 AGGGTGTTGAAGATGGAAGAAGG + Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067938493 10:50631973-50631995 TGGTTGCTAATTAGAGAAGAAGG - Intergenic
1068344718 10:55760020-55760042 TGGAGATTGAGTAGGGAAGAGGG + Intergenic
1069609491 10:69763280-69763302 TGGTAGTTGAGTGGGGAAGTGGG + Intergenic
1070041982 10:72790348-72790370 TGGGTGTGGAAGAAGGAAGAGGG - Intronic
1070861826 10:79674256-79674278 TGGAGATTGAGTAGGGAAGAGGG - Intergenic
1070875323 10:79800343-79800365 TGGAGATTGAGTAGGGAAGAGGG + Intergenic
1071093616 10:81948371-81948393 AGGTTGTATAGTAGGGAAGAAGG + Intronic
1071380949 10:85058988-85059010 CTGTTGTTGAGTAGGGGAGAAGG + Intergenic
1071642250 10:87322485-87322507 TGGAGATTGAGTAGGGAAGAGGG + Intergenic
1072884665 10:99262676-99262698 TGGTTTTTGAACAGGTAAAATGG - Intergenic
1073224471 10:101905546-101905568 TGGTAGGTGAAAAGTGAAGAGGG + Intronic
1076164142 10:128268465-128268487 TGTTTCCTGAACAGGGAAGAAGG + Intergenic
1077813810 11:5665910-5665932 AGGGTGCTAAATAGGGAAGAGGG - Intronic
1080221578 11:29911714-29911736 TGGTTGTTGTATAGAGAGAATGG + Intergenic
1082834263 11:57640134-57640156 TGGCTGTGGATTAGGGAAGAAGG + Intergenic
1083400407 11:62419364-62419386 GGGTTGTTGGATATAGAAGATGG - Intronic
1083427755 11:62597582-62597604 GGGTGGGTGGATAGGGAAGATGG - Intronic
1085428948 11:76430051-76430073 TCGTAGTTGAGTGGGGAAGATGG - Intergenic
1085798071 11:79562026-79562048 GGGTTGGTGAATATGGAAGTAGG + Intergenic
1086240321 11:84682560-84682582 TGGTTGCTGAATAGAGCTGAAGG + Intronic
1086970634 11:93077002-93077024 GGGCTGTTGAATAGGAAAAAGGG + Intergenic
1087048222 11:93862139-93862161 TGGTTATAGAAAAGGGAAAAGGG + Intergenic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088399305 11:109405549-109405571 AGTTTGTTGAAAAGGTAAGAAGG + Intergenic
1089384037 11:118056404-118056426 TGGGTGTTGATTAGGCAACAGGG + Intergenic
1090714264 11:129416277-129416299 TGGTTGTTGAGGAGTGAGGAGGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091546956 12:1507572-1507594 TGCTTGTTGACTAGGCGAGAGGG - Intergenic
1091863924 12:3813162-3813184 TGGATGTTGACAAGGGAACAGGG - Intronic
1092723584 12:11464804-11464826 TGGTTTTAGGATAGGTAAGATGG + Intronic
1093091296 12:14924006-14924028 TGGTGATGGAAGAGGGAAGAGGG - Intronic
1093449119 12:19295734-19295756 TGGTTGTAAGATAGAGAAGAAGG + Intronic
1094436305 12:30424338-30424360 TTGCTGTTGAATAGGAAAGTAGG + Intergenic
1094505523 12:31057678-31057700 TGGTTTTTTAAAAAGGAAGAAGG - Intergenic
1095139837 12:38647999-38648021 TGGTTGTTTAATAGTGAGGTGGG - Intronic
1095998877 12:48112756-48112778 TGGTTTTTGGATAGGTAAAATGG + Intronic
1097837161 12:64284556-64284578 AGGGTGTTGAACAGGGAAGTTGG + Intronic
1098920051 12:76294547-76294569 TGGTTTTTGAACAGGTAAAATGG - Intergenic
1099206798 12:79737816-79737838 TGGATGTTGGAAAGAGAAGAAGG - Intergenic
1102400032 12:112620817-112620839 TGGATGTGGAGTAGGAAAGAAGG - Intronic
1102833345 12:116028572-116028594 TTGATGTTGAATAGGGGTGAAGG - Intronic
1102867684 12:116386992-116387014 TGGGTGTTGACTTGGGCAGATGG - Intergenic
1107646666 13:42501153-42501175 TGTTTGTTGAAGTGGGAAAAGGG + Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109585745 13:64400803-64400825 TGGTTTTTGAATATGGTATAAGG + Intergenic
1110938914 13:81324307-81324329 TAGTTGTTGAATAGGGTGGAAGG + Intergenic
1112884237 13:104148731-104148753 TGGTTTTTGAATTGAGTAGAGGG - Intergenic
1114140551 14:19905010-19905032 GGCTTGTTGAATAGGGAAAAGGG - Intergenic
1114251752 14:20967884-20967906 TGGTTGATGAAGGTGGAAGAAGG + Intergenic
1116711846 14:48378214-48378236 TGGTAGTGAAGTAGGGAAGAGGG + Intergenic
1117399602 14:55346700-55346722 TGGTGGTTGAAGAGGGAATTTGG + Intronic
1118942453 14:70350060-70350082 TGGTTATAGAAAAGGGAAAAGGG - Intronic
1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG + Exonic
1120125374 14:80735827-80735849 TGCTTATTGAAGATGGAAGAGGG - Intronic
1120607668 14:86599356-86599378 TGGATGTTGCAAAGGGAGGAAGG + Intergenic
1120838053 14:89058596-89058618 TTGCTGTTTAATAGGGAAGTTGG + Intergenic
1121434419 14:93909736-93909758 AGGTTGTTGCATGGGGAAGCGGG + Intergenic
1122600560 14:102919639-102919661 TGGATGGTGAATGGGGATGATGG - Intergenic
1122955886 14:105070824-105070846 GGGATGTTGAACTGGGAAGAAGG + Intergenic
1123777719 15:23597229-23597251 TTGCTGTTGAATAGGAAAGCAGG - Intronic
1124062682 15:26308475-26308497 TTGCTGTTGAATGGGGAAGTGGG + Intergenic
1124490309 15:30151250-30151272 TGGTTGGTGACCAGAGAAGAGGG - Intergenic
1124753224 15:32387079-32387101 TGGTTGGTGACCAGAGAAGAGGG + Intergenic
1124974964 15:34522779-34522801 TGGTTGGTGACCAGAGAAGAGGG + Intergenic
1125093241 15:35820017-35820039 TGGATATTGAATATGAAAGAGGG - Intergenic
1126692671 15:51299836-51299858 TGGTTGTTGAGTCCAGAAGAGGG + Intronic
1127808813 15:62545369-62545391 TGTCTGTTGAAGAGGAAAGAGGG + Intronic
1127899637 15:63331410-63331432 TTGTTTCTGAATAGGAAAGAAGG + Intronic
1129259580 15:74357016-74357038 TGGTTTTTGAACAGGTAAAATGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129874692 15:78965990-78966012 TTGGTGTTGAATAAGGCAGAGGG + Intronic
1129976102 15:79823083-79823105 AGGTTGTTGGGTAGAGAAGATGG - Intergenic
1130304701 15:82705335-82705357 TGGTTTTTGAACAGGTAAAATGG - Intronic
1130380959 15:83372036-83372058 TGGTAGTTGAATGGGGAAGAAGG + Intergenic
1131871859 15:96772023-96772045 TGTTTACTGAAAAGGGAAGAAGG + Intergenic
1131875619 15:96803053-96803075 GGATTGCTGAATATGGAAGACGG + Intergenic
1132316103 15:100891640-100891662 TGGTGATTGAAAAAGGAAGAAGG - Intronic
1133545571 16:6802928-6802950 TATTTATTGAAGAGGGAAGATGG + Intronic
1134234291 16:12453297-12453319 TGGTGGTTGCCTGGGGAAGATGG - Intronic
1134289509 16:12892460-12892482 TGTTTCTTGAAGAGGGAGGAGGG - Intergenic
1134750587 16:16621772-16621794 TTGTTGTTGAATGGGAAAGTGGG + Intergenic
1134787833 16:16961121-16961143 CTGTTGTTGAATAGGCAGGAGGG - Intergenic
1134994867 16:18731814-18731836 TTGTTGTTGAATGGGAAAGTGGG - Intergenic
1137363574 16:47841617-47841639 TGGTTTTTGAACAGGTAAAATGG - Intergenic
1137494035 16:48955620-48955642 TGGTTAATGAATAGGGAAATGGG + Intergenic
1137961122 16:52883246-52883268 TGGCCGTTGCAAAGGGAAGATGG + Intergenic
1143016884 17:3895535-3895557 TGGTTGGGGAAGAGGGCAGAAGG + Intergenic
1143854332 17:9837499-9837521 GGGTTGTTAGATGGGGAAGAAGG + Intronic
1146596117 17:34170538-34170560 TGTTTGTTGAATGGAGATGATGG - Intronic
1146702673 17:34974972-34974994 TGGTTGTTGTGTAGAGAAGTTGG - Intronic
1148001379 17:44389470-44389492 AGGTTGTGGAAGAAGGAAGATGG - Exonic
1149258209 17:54850918-54850940 AGGCTATTGAAAAGGGAAGATGG + Intergenic
1150611888 17:66739822-66739844 TGGCTGTGGAGGAGGGAAGAGGG + Intronic
1151001035 17:70376949-70376971 TGATTGTTAAATAGGAAAAAAGG + Intergenic
1151133497 17:71922840-71922862 TGGTTCTTCTATAGGTAAGAAGG - Intergenic
1154020274 18:10658514-10658536 TGGTTGACAAAAAGGGAAGATGG + Intergenic
1154384251 18:13879404-13879426 TGGTTGTTGAGTAGGGACAATGG + Intergenic
1154956593 18:21263740-21263762 TGGTTATTGACTAGAGAAGTAGG + Intronic
1156558671 18:38096736-38096758 TGAGTGTTAAATGGGGAAGATGG + Intergenic
1157079551 18:44508031-44508053 TGTTTTTTGAGTAGGGAACAGGG - Intergenic
1157920628 18:51709762-51709784 TGGTTATAGAAAAGGGAAAAGGG - Intergenic
1159201799 18:65195942-65195964 TTGTTGTAGATTAGGGAAGATGG - Intergenic
1161878566 19:6931055-6931077 TGGGTGGGGAACAGGGAAGAGGG - Intronic
1162697943 19:12491317-12491339 TGTTTTTTGAATAGAGACGAGGG - Intronic
1165159683 19:33808688-33808710 TGGCTGTTGGGTGGGGAAGAAGG + Intronic
926472281 2:13275772-13275794 TGGGGGTAGAAAAGGGAAGAAGG - Intergenic
927029957 2:19110750-19110772 GGTTTATTGAAGAGGGAAGATGG - Intergenic
927099951 2:19780461-19780483 TGATTGTAGAATAGGGAGGAGGG - Intergenic
927481839 2:23460191-23460213 TGGCTGTTGACAAGGAAAGAAGG - Intronic
929086792 2:38175980-38176002 TGGTTGCTAAAGAGGGGAGATGG + Intergenic
933167494 2:79092433-79092455 TGGTTATAGAAAAGGGAAAAGGG + Intergenic
933534128 2:83551404-83551426 TGATTCTTCAATAAGGAAGAGGG - Intergenic
933881863 2:86677680-86677702 TGGTTGTTGCATATGGCAGTGGG + Intronic
935181225 2:100692743-100692765 TGGTTGTTTTGTTGGGAAGAGGG - Intergenic
935327455 2:101949609-101949631 TTGTTTTTGAATATGGAATAAGG - Intergenic
937278503 2:120701854-120701876 TGGCTGTTGAGTAGGGCTGAGGG - Intergenic
939808599 2:146805160-146805182 TAGATGTGGAAAAGGGAAGAGGG + Intergenic
940183841 2:150961395-150961417 TGGTTTTTGAACAGGTAAAATGG - Intergenic
942474044 2:176296618-176296640 TTGTTTTTTAATGGGGAAGAGGG - Intronic
943016558 2:182517573-182517595 CTGTGGTTGAATAGGGAAGGTGG + Intronic
944049591 2:195452267-195452289 AGATTGTTGAATTGGGAAGCTGG - Intergenic
944116564 2:196193216-196193238 TTGTTATTGAAGGGGGAAGAGGG - Intergenic
944302614 2:198141622-198141644 TGGTTTTTGAATTAGTAAGATGG + Intronic
944882044 2:204023189-204023211 TGGGTGTTGGATGGTGAAGAAGG - Intergenic
945554833 2:211264557-211264579 TGGTTTTTGGACAGGGAAAATGG - Intergenic
1168736839 20:147639-147661 TTCTTGTTGAATAAGTAAGAGGG + Intergenic
1169173963 20:3492120-3492142 TGGTTGTTGAATATACAAGAAGG + Intronic
1169626280 20:7573365-7573387 TGCTTATTGAATAGTGAAGGTGG - Intergenic
1169750445 20:8987407-8987429 TGGTAGCTGAAGTGGGAAGAAGG - Intergenic
1172956449 20:38762964-38762986 TGTGTGTTTAAAAGGGAAGAGGG + Intronic
1173355587 20:42285394-42285416 TGATTTTTGAATAGAGCAGAGGG + Intronic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1173622246 20:44445546-44445568 TGGTTGGTACATTGGGAAGAAGG - Intergenic
1173645732 20:44632066-44632088 TGGTTGTTGAGGAGGGAGGCTGG - Intronic
1175705438 20:61173206-61173228 TGGTTGATGGATAGTGGAGATGG - Intergenic
1176671598 21:9739939-9739961 TGGTTGTTTAAGAGATAAGAAGG - Intergenic
1176685860 21:9847977-9847999 TGGTGTTTGAATAGGTAAAATGG - Intergenic
1178889744 21:36511032-36511054 TGGATGTAGAAAAGGGGAGAAGG + Intronic
1180028626 21:45185153-45185175 TGGTTGTGGAAAAGGGAGGTTGG - Intronic
1181741817 22:24927215-24927237 TGGCTGTTGACTAGGGCAGTGGG + Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
951762646 3:26162993-26163015 TGGTTTTTGAACAGGTAAAATGG + Intergenic
953076977 3:39580420-39580442 TGGTTTTTGGATAGGTAAAATGG + Intergenic
953656410 3:44858299-44858321 CGGTTTTTGAATAGGTAAAATGG + Intronic
953690256 3:45111889-45111911 CGTTTGTTTAATAGAGAAGAGGG + Intronic
954733810 3:52687996-52688018 CAGTTGTTAAATAGGTAAGATGG - Intronic
955961871 3:64348834-64348856 TGATTGTTGTCTAGGCAAGATGG + Intronic
956545799 3:70400642-70400664 TGGTTGTTGGCTAGGCAAGGTGG + Intergenic
958422089 3:93940849-93940871 TGGTTTTTGAATAGGTAAAATGG - Intronic
961519451 3:127458368-127458390 TGGTTAGTTAATAGGGAAAATGG + Intergenic
963061286 3:141229366-141229388 TGGTTGCTGAAGAGGCAGGATGG - Intronic
963275753 3:143328539-143328561 AGGGTTTTGAATCGGGAAGATGG - Intronic
963659747 3:148110329-148110351 TGGATGTTGAATAGGTAAAAAGG + Intergenic
965167612 3:165215965-165215987 TGGTGGTTGAATCCTGAAGAAGG + Intergenic
965857726 3:173109117-173109139 TGGTAGTAGAGTATGGAAGAGGG - Intronic
965991599 3:174825659-174825681 TGTTTAAGGAATAGGGAAGAAGG - Intronic
966339239 3:178906565-178906587 TGGTTTTTCAGTAAGGAAGACGG + Intergenic
972313258 4:37900769-37900791 TGGTTGTTGAAAACAGAAAAGGG + Intronic
974616772 4:64296283-64296305 TGGTCATTGATTAGTGAAGAGGG - Intronic
974676028 4:65090374-65090396 TGGTCTCTGAATAGGAAAGATGG + Intergenic
975545881 4:75560105-75560127 TGGTTTTTGGAGAGGGAAGGAGG + Intronic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
977915737 4:102590708-102590730 TGGTTGTGTGATAGGGAATAGGG - Intronic
977922190 4:102658033-102658055 TGGTTGTTGAATAGGGAAGAAGG - Intronic
977968590 4:103186294-103186316 TGGTTCTTGAATAAAGAATAAGG - Intronic
978212167 4:106150154-106150176 AGATTGTTGAATAGTGAAAAGGG + Intronic
978573647 4:110166759-110166781 GGGTTGATGAAAAAGGAAGACGG - Intronic
978975957 4:114872922-114872944 TTGTTGTTGAAAAGGGCAAAAGG - Intronic
979947337 4:126849481-126849503 TGGTCTTTGAGTAGGTAAGAGGG + Intergenic
980349319 4:131666455-131666477 TGGTTTTTGAATAGGTAAAATGG - Intergenic
981040387 4:140216583-140216605 TGGTTTTGGAATAGGTAAAATGG - Intergenic
982171963 4:152670920-152670942 TGGCTGTTAAGTAGGGACGATGG + Intronic
982196359 4:152919426-152919448 TGTTTGTTGGGTGGGGAAGAAGG + Intergenic
984165094 4:176296617-176296639 AGGGTGAGGAATAGGGAAGAAGG + Intergenic
985349168 4:189039282-189039304 TGGTTTTTGAATATAGAAAAAGG + Intergenic
986662422 5:10071263-10071285 TGGCTGTGGCCTAGGGAAGAAGG + Intergenic
986765773 5:10924649-10924671 TGGATGCTAAATAGGAAAGATGG - Intergenic
987207372 5:15641333-15641355 TGGTTGTAGAGTCTGGAAGAAGG - Intronic
987261071 5:16204008-16204030 TGGGTGTGGGAGAGGGAAGAGGG + Intergenic
987840457 5:23216979-23217001 TGCTTGTAGAATAGGGAGAAAGG - Intergenic
988921949 5:35951265-35951287 TGGTGTTTGAATAGGGTGGAAGG - Exonic
988995305 5:36709317-36709339 TAGTTGTTGATTAAGGGAGAGGG + Intergenic
991135833 5:63180719-63180741 TGGTTGTTGAAGAGAAGAGAGGG + Intergenic
991585327 5:68196204-68196226 TGGTTGATGGTTAGGGGAGAGGG - Intronic
993064219 5:83077908-83077930 TGGTTGTGGGATTGGGAGGACGG + Intronic
994819062 5:104624930-104624952 CTGCTGTTGAATTGGGAAGAAGG + Intergenic
995014518 5:107294912-107294934 TGCTTGTTGCCTAGGGCAGAAGG - Intergenic
995539158 5:113167612-113167634 TGGTTATTGAAAGGGGAAGGTGG - Intronic
995903173 5:117093661-117093683 TGCTTGTTGCTTAGGGAAGGTGG - Intergenic
1000312591 5:160059611-160059633 TTGTTGTGGCTTAGGGAAGAGGG + Intronic
1001354158 5:171004014-171004036 CGGTTTTTGAATAGGTAAAATGG + Intronic
1003033789 6:2624896-2624918 TTGTTGTTGAATGGGGAATCTGG + Intronic
1004397269 6:15256372-15256394 TGGATGGTGAATTGGAAAGAGGG + Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1008011432 6:46471859-46471881 TGGTTGTTGACTGTTGAAGAAGG - Intronic
1008162348 6:48093789-48093811 TGGTCCATGAATAGGGATGATGG + Intergenic
1008422008 6:51311998-51312020 TTTTTGTTGAATAGAGAAGCAGG - Intergenic
1009751941 6:67886406-67886428 TGGTTTTTGAACAGGTAGGATGG + Intergenic
1009809397 6:68640627-68640649 TGGTTGAGGAAAAGGAAAGAGGG - Intronic
1011186525 6:84682703-84682725 TGGTTCTTGAATAGGATATAGGG + Intergenic
1012368727 6:98476773-98476795 TGATTGTTGCTTGGGGAAGATGG + Intergenic
1012949352 6:105501617-105501639 TGGTTGCTGGAGAGAGAAGAAGG + Intergenic
1014152407 6:118072923-118072945 TGGAGGTGGAGTAGGGAAGATGG + Intronic
1014878527 6:126692268-126692290 TGGTGGTTGCTTAGGAAAGAGGG + Intergenic
1015685319 6:135852422-135852444 GGTTTGTGGAACAGGGAAGAAGG + Intronic
1015929378 6:138342035-138342057 TGGTGGTTGAAAAGGGTGGAAGG - Exonic
1017922674 6:158885654-158885676 TGGTTTTTGAACAGGTAAAATGG + Intronic
1018407006 6:163496532-163496554 TGGTTGCTGAAAAGAGAAAAGGG - Intronic
1019115505 6:169758163-169758185 TGGCTGTTGAGAAGGGAATATGG - Intronic
1019379981 7:716150-716172 TGGATGTTGAAGTGGGAGGATGG - Intronic
1020894446 7:13922251-13922273 TGGTTGCTGAGAAGAGAAGAAGG + Intronic
1020976699 7:15015582-15015604 TGGGTGGAGAATGGGGAAGATGG - Intergenic
1021058453 7:16080055-16080077 AGGTGGTTGGATAGGGAAGAAGG + Intergenic
1022003955 7:26250190-26250212 TGGTTATAGAAAAGGGAAAAGGG - Intergenic
1023203803 7:37726327-37726349 TGGTTGCTGAGTTGGGAATAGGG + Intronic
1023763595 7:43489752-43489774 TGGGTGTGGAATATGGAAGTGGG + Intronic
1024944600 7:54796193-54796215 TGGTTCTTTAATAAAGAAGAGGG + Intergenic
1027194904 7:76023250-76023272 TGGTGGTGGAATTGGGAAGATGG - Intronic
1028044709 7:86103563-86103585 TATTTGTTGAAGATGGAAGAGGG - Intergenic
1028088349 7:86666324-86666346 TGGCTGTTGAAAAGGCAACATGG - Intronic
1029029823 7:97455774-97455796 TGGGTTTTGAATGGGCAAGAAGG - Intergenic
1029191613 7:98776078-98776100 TGTTTGATGAAGGGGGAAGAGGG + Intergenic
1030154854 7:106444265-106444287 TAGTTTTTGAATATGGATGATGG + Intergenic
1030827000 7:114170332-114170354 TCGTTGTTTTTTAGGGAAGAGGG - Intronic
1031099828 7:117465818-117465840 TGAGTGTTGAAAAGGTAAGAGGG + Intronic
1032388995 7:131543688-131543710 TGGTTGTTGGACAGGGGAAAGGG + Intronic
1032538565 7:132684883-132684905 TGGTGGATGAGTGGGGAAGAGGG - Intronic
1033625721 7:143107901-143107923 TGGTTTTTGGATAGGTAAAATGG - Intergenic
1034582321 7:152055968-152055990 GGGTTGTGGAAGGGGGAAGATGG - Intronic
1034865696 7:154639820-154639842 AGGTTGTTGAACAGGGATAAAGG - Intronic
1039631434 8:39115909-39115931 TGGTTATTGAATATGGCAAAAGG + Intronic
1039771896 8:40695508-40695530 AGGTTGCTGGATAGGCAAGAAGG - Intronic
1040370585 8:46768549-46768571 TGCTTATTGAATGGGGAAGCGGG - Intergenic
1040976828 8:53202761-53202783 TGGTTGTTGGGAAGGCAAGAGGG + Intergenic
1041398360 8:57415950-57415972 TGATTGTTGAAAAGGCAAAAGGG + Intergenic
1041787629 8:61652588-61652610 TGGCTGTTGTAGAGGGGAGAGGG + Intronic
1042226724 8:66520286-66520308 TGTGTTTTGAACAGGGAAGATGG - Intergenic
1044864717 8:96559323-96559345 TGGAGATTGAATAGTGAAGAGGG + Intronic
1044945545 8:97385605-97385627 TGGATGGTGAAAAGGGAAGCAGG + Intergenic
1045643493 8:104278260-104278282 TTGCTGTTGAATAGGAAAGCAGG - Intergenic
1047209562 8:122830452-122830474 TGGTTATAGAAAAGGGAAAAGGG + Intronic
1047234449 8:123027575-123027597 TAGTTGTTGAGTAGGGAATGAGG + Intronic
1048851566 8:138650232-138650254 TGGTTTCTGAACAAGGAAGAAGG + Intronic
1049002539 8:139835163-139835185 TGGTTTTTAAATAGGGGAGTTGG + Intronic
1049942674 9:563096-563118 TGGTTATTTAAGAGGAAAGATGG + Intronic
1051893883 9:21969213-21969235 TGTTTGTTTAATAGAGACGAAGG - Intronic
1052216587 9:25973218-25973240 TGGTTCTTGAACAGGAGAGAAGG + Intergenic
1052403879 9:28034242-28034264 TGGTTGTTGAATAGGTAGAGGGG + Intronic
1052788127 9:32848945-32848967 TGGTTGCTGAGTAAAGAAGATGG - Intergenic
1055276136 9:74619156-74619178 TGGTGGTTGAAGAGTGAAAAAGG - Intronic
1056138920 9:83655672-83655694 TGCTTGTTGAATAGTGTAGAAGG - Intergenic
1056331176 9:85522593-85522615 AGGCTGTTGAGTAGGGAAGTGGG + Intergenic
1056419607 9:86410701-86410723 TGGCTTTTGAGTAGGGAAGCTGG - Intergenic
1056764812 9:89438116-89438138 TGAGTGTGGAAGAGGGAAGAGGG + Intronic
1056782833 9:89564206-89564228 TTTTTGTTGAATGGGGAATAAGG + Intergenic
1057068276 9:92074703-92074725 TGGTTTTTGAATAGGTAGGATGG - Intronic
1057211609 9:93203729-93203751 TGGGTGTGGAAGAGGGAGGAAGG + Intronic
1057941205 9:99286390-99286412 AGGTTTTAGAATAGGGAAAAGGG - Intergenic
1059073072 9:111159985-111160007 TTGTTGTTGAGTTGGCAAGATGG - Intergenic
1060870352 9:127034928-127034950 TGGAAGTTGAACAGGGAGGAAGG - Intronic
1061874765 9:133538208-133538230 TGGGAGTTGAGTAGGGAGGAAGG + Intronic
1062195614 9:135272306-135272328 TTGTTGTTTCATAGGTAAGACGG - Intergenic
1186285856 X:8043509-8043531 TGGTTGTGAAATAAGGAGGAAGG + Intergenic
1187830290 X:23374250-23374272 TTCTTGTTGAAAAGGGAGGAGGG - Intronic
1190879343 X:54481904-54481926 TGGTTGTGGTGTAGGGAAGGGGG - Intronic
1193075925 X:77355551-77355573 GTGGTTTTGAATAGGGAAGAGGG + Intergenic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1195326715 X:103764400-103764422 TGGTTTTTGGATAGGTAAAATGG + Intergenic
1196294177 X:113979909-113979931 TTGCTGTTGAATGGGAAAGAGGG + Intergenic
1197142549 X:123132481-123132503 TGGTTATAGAAAAGGGAAAAGGG - Intergenic
1197852639 X:130879467-130879489 TGGGTGTTGAAGAGATAAGATGG - Intronic
1198990719 X:142511603-142511625 AGGTAGGTGAATAAGGAAGATGG + Intergenic
1199315135 X:146367968-146367990 TGGTTTTTCAAAAGGGAGGAAGG + Intergenic
1199442646 X:147885879-147885901 TGATTTTTGAATAGGGCATATGG - Intergenic
1199661673 X:150056971-150056993 TGATTGCTAAAAAGGGAAGAAGG - Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1200205848 X:154315664-154315686 TGGTTGCAGAATTGGGCAGAAGG - Intronic
1201649705 Y:16272284-16272306 TGATTATTGAATACTGAAGAGGG - Intergenic
1202062230 Y:20899660-20899682 CAGTTTTTGAATAGGGAAAATGG - Intergenic