ID: 977923585

View in Genome Browser
Species Human (GRCh38)
Location 4:102672852-102672874
Sequence GTTTTTCTACAGATTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 10, 3: 82, 4: 445}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977923585_977923594 18 Left 977923585 4:102672852-102672874 CCACCCCCAATCTGTAGAAAAAC 0: 1
1: 0
2: 10
3: 82
4: 445
Right 977923594 4:102672893-102672915 TTATTGGTGCCAAAAAGGTTTGG 0: 2
1: 8
2: 192
3: 1404
4: 1881
977923585_977923591 2 Left 977923585 4:102672852-102672874 CCACCCCCAATCTGTAGAAAAAC 0: 1
1: 0
2: 10
3: 82
4: 445
Right 977923591 4:102672877-102672899 TCTTCCATGAAACTGGTTATTGG 0: 1
1: 0
2: 52
3: 437
4: 875
977923585_977923590 -5 Left 977923585 4:102672852-102672874 CCACCCCCAATCTGTAGAAAAAC 0: 1
1: 0
2: 10
3: 82
4: 445
Right 977923590 4:102672870-102672892 AAAACTGTCTTCCATGAAACTGG 0: 89
1: 509
2: 773
3: 894
4: 834
977923585_977923595 19 Left 977923585 4:102672852-102672874 CCACCCCCAATCTGTAGAAAAAC 0: 1
1: 0
2: 10
3: 82
4: 445
Right 977923595 4:102672894-102672916 TATTGGTGCCAAAAAGGTTTGGG 0: 1
1: 1
2: 16
3: 252
4: 1716
977923585_977923593 13 Left 977923585 4:102672852-102672874 CCACCCCCAATCTGTAGAAAAAC 0: 1
1: 0
2: 10
3: 82
4: 445
Right 977923593 4:102672888-102672910 ACTGGTTATTGGTGCCAAAAAGG 0: 1
1: 3
2: 91
3: 609
4: 1124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977923585 Original CRISPR GTTTTTCTACAGATTGGGGG TGG (reversed) Intronic
901714232 1:11140295-11140317 ATTATTCCACAGATTGGGTGGGG + Intronic
902139503 1:14341063-14341085 TTTTTAGTAGAGATTGGGGGGGG + Intergenic
902312684 1:15593689-15593711 GTTTGTCTCCAGGTTGGCGGAGG - Intergenic
902321674 1:15672052-15672074 CTGTGTCTACAGCTTGGGGGAGG + Intergenic
902759659 1:18572885-18572907 GTTTCTCTGCAGAATGGGGAGGG - Intergenic
903019700 1:20385516-20385538 GTTTTACTGAAGATCGGGGGAGG - Intergenic
903704618 1:25276518-25276540 TTTTTTTTAGAGATGGGGGGGGG - Intronic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904636420 1:31884958-31884980 GTTTTTGTAGAGACTGGTGGCGG - Intergenic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905123510 1:35701099-35701121 GTTTTTCAACGGACTGGGGGAGG - Intergenic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
907481140 1:54746327-54746349 ATTTTTCCACAGGATGGGGGAGG - Intergenic
907846448 1:58212730-58212752 GTTTTTCTCCTAATTAGGGGTGG - Intronic
908508428 1:64829311-64829333 GATTTTCCAAAGACTGGGGGAGG - Intronic
909346958 1:74601479-74601501 GTTTTTCAACACAATGGGGCTGG + Intronic
909629241 1:77753414-77753436 TTTTTTGTAAAGATGGGGGGTGG - Intronic
909711171 1:78651132-78651154 ATTTTTCCACAGACTGGTGGTGG + Intronic
910977143 1:92918757-92918779 GTTTTGCAACAGATGGGGTGGGG + Intronic
912201135 1:107459616-107459638 GATTCTTTACAGGTTGGGGGAGG + Intronic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
916101948 1:161400158-161400180 GTTTTTCTCCAGTTTCCGGGGGG - Intergenic
916236495 1:162594053-162594075 ATTTTTCCACAGACTTGGGGTGG + Intronic
916579041 1:166091310-166091332 GATTTCCTACATATTGGGGGAGG + Intronic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
916629913 1:166601224-166601246 GTTTTTCCACAGACTGGTAGGGG + Intergenic
917819931 1:178752325-178752347 TTTTTTGTAGAGATTGGTGGCGG + Intronic
918041331 1:180915939-180915961 GTTTTTCCATGGATCGGGGGCGG - Intronic
919209414 1:194460151-194460173 GTTTTTCGAAAGAATGGAGGAGG + Intergenic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
919962031 1:202480955-202480977 ATTTTTCCACAGACTGGTGGGGG + Intronic
920354659 1:205361919-205361941 TTTTTGATAGAGATTGGGGGTGG - Intergenic
921322422 1:213954906-213954928 GTTTTTCCACAGACCGGGGTGGG + Intergenic
921375305 1:214467174-214467196 GTTTTTCTTTGGGTTGGGGGTGG - Intronic
921983318 1:221282503-221282525 GTTTTTAAGCAGATTGGGAGAGG - Intergenic
922431661 1:225560667-225560689 GTTTTTATAAATATTGGGGTGGG + Intronic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
923616745 1:235544655-235544677 TTTTTTCCACAGATGTGGGGTGG - Intergenic
923883656 1:238131253-238131275 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
924158140 1:241202740-241202762 GTTTTTATACAGAAGTGGGGAGG + Intronic
924194108 1:241587118-241587140 GTGTTTCCACAGACAGGGGGTGG + Intronic
924240350 1:242034067-242034089 GTTTTTGTAGAGATGGGGGGGGG - Intergenic
924349462 1:243101138-243101160 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063671380 10:8102670-8102692 TTTTTTGTAAAGATTGGGGTGGG - Intergenic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064558222 10:16568721-16568743 CTTTTTCCACAGACTGTGGGTGG - Intergenic
1064605039 10:17030289-17030311 GTTTTTCCACGGACCGGGGGTGG - Intronic
1064738361 10:18407045-18407067 GTTTTTCTGCAGATTTGTGAAGG + Intronic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065367757 10:24952340-24952362 GAGTTTCGTCAGATTGGGGGCGG + Intronic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065754640 10:28919957-28919979 GTTTTTCCACGGACTGGGGCAGG + Intergenic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069267617 10:66482040-66482062 GTTTTTGTATGTATTGGGGGAGG + Intronic
1070375350 10:75825282-75825304 GTTTTTCTACAAACTTTGGGTGG + Intronic
1070402817 10:76068405-76068427 ATTATTCCACAGACTGGGGGTGG + Intronic
1071829406 10:89356783-89356805 GTTTTTCCACAGACTGGGCAGGG - Intronic
1071953898 10:90735836-90735858 ATTTTTGTAGAGATGGGGGGTGG - Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072292366 10:93975884-93975906 GTTTTTGTAGAGATGTGGGGGGG - Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1072812985 10:98478000-98478022 GTTTTTCCACAGACTGTTGGGGG - Intronic
1072844846 10:98818286-98818308 TTTTTTCCACAGGCTGGGGGTGG + Intronic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074989027 10:118685871-118685893 GTTTATCTACAGATTCTGTGAGG - Exonic
1075093753 10:119457863-119457885 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1075113362 10:119605818-119605840 CTTTTTGTACAGATTTGGGGGGG - Intergenic
1075148149 10:119901030-119901052 TTTTTTTTAAAGAGTGGGGGGGG + Intronic
1075290410 10:121225163-121225185 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1075630691 10:123999026-123999048 GTTTTTCCACAGTTTGGTGGGGG + Intergenic
1076450446 10:130553605-130553627 GTTTTTCCATGGATCGGGGGAGG + Intergenic
1076621232 10:131789448-131789470 ATTTCTCCACAGACTGGGGGTGG - Intergenic
1077894166 11:6441311-6441333 GTTTATCTCCACAATGGGGGAGG + Intronic
1078099629 11:8322319-8322341 GTTTTTCCACAGATCGGGTAGGG - Intergenic
1078252446 11:9627451-9627473 TTTTTTGTAGAGATTGGGGGGGG + Intergenic
1078261842 11:9716755-9716777 GTTTATCTACAGCTTGTGAGAGG + Intronic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1079228094 11:18625742-18625764 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080617116 11:33954299-33954321 GTATGTCTACAGATAGTGGGTGG + Intergenic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1081262396 11:40976844-40976866 TTTTTTCCACAGACTGGGGCAGG + Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083177567 11:60960893-60960915 GTTTTTATACAGAAAGGTGGAGG + Intergenic
1084011646 11:66353443-66353465 TTTTTTTTACAGATTGAAGGTGG + Intronic
1085591304 11:77763896-77763918 ATTTGTCCACAGACTGGGGGTGG + Intronic
1085885608 11:80518287-80518309 ATTTTTCCACATACTGGGGGTGG - Intergenic
1085898077 11:80663652-80663674 ATTTTTCTACAGACTAGGGTGGG - Intergenic
1086359670 11:86044898-86044920 GTTTTTCCACAGACTGGCAGGGG - Intronic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1087369821 11:97269464-97269486 TCTTTTCTACAGATTAGGTGGGG + Intergenic
1089268231 11:117282199-117282221 GTTTGTCTACTGGTTGGGGCCGG - Exonic
1090347559 11:126083396-126083418 GTTTTATTAATGATTGGGGGAGG - Intergenic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092957937 12:13567141-13567163 GGTCTTCTACATGTTGGGGGCGG - Exonic
1093176364 12:15917733-15917755 GTTTTTCCACAGACTGGGGTAGG + Intronic
1093201319 12:16190241-16190263 GTTTTTCTGGAGGTTGGGGATGG - Intronic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1095322662 12:40847834-40847856 GTTTTTCCACGGATGGGGTGAGG + Intronic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095757328 12:45783525-45783547 GTTTTTCCACAGACTGTGGCAGG + Intronic
1096300156 12:50419726-50419748 GTTTTTGTAGAGATGGGGTGTGG - Intronic
1096855224 12:54476597-54476619 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1097545241 12:60991271-60991293 GTTTTGGTACAGATTGGCTGTGG + Intergenic
1097728995 12:63106502-63106524 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1098486555 12:71028253-71028275 GTTTTTCAACAGACAGGGGAGGG - Intergenic
1098658056 12:73057812-73057834 GTTTTTCTACAGACAGAAGGTGG - Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100989882 12:100240336-100240358 GTTTTTGTAGAGATAGGGGCAGG + Intronic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101026428 12:100611552-100611574 GTTTTTCCACAGATTTGGGCGGG + Intronic
1101262460 12:103046773-103046795 GTTTTTCCACGGACTGGGGAAGG - Intergenic
1101621464 12:106392861-106392883 GTTTTTCTGCAGCTTGGGCAAGG + Intronic
1101713294 12:107288484-107288506 ATTTTTGTAGAGATTGGCGGTGG - Intergenic
1102509313 12:113403539-113403561 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1102596187 12:113994199-113994221 TTTTTTGTAGAGATGGGGGGCGG - Intergenic
1102652200 12:114449869-114449891 CCTTTTCTCCAGATGGGGGGAGG - Intergenic
1102919373 12:116780285-116780307 GTTTTTCCACAGATCAGGGTGGG + Intronic
1103865386 12:124047741-124047763 GTTTTTCTGCAGATGGGGGCAGG - Intronic
1104849624 12:131865790-131865812 CTTTTTGTAGAGATTGGGGGCGG - Intergenic
1106311044 13:28554581-28554603 ATTTTTTTAGAGATTGGGGTGGG + Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1107609672 13:42100452-42100474 GTTTTTCCATGGATCGGGGGTGG - Intronic
1108263785 13:48684099-48684121 CTTTTTGTAGAGATCGGGGGGGG + Intronic
1108354412 13:49617442-49617464 TTTTTTGTAGAGATTGGGGTGGG - Intergenic
1108641398 13:52385657-52385679 GTTTTTCCACAGTTTTGGTGGGG + Intronic
1110358362 13:74595502-74595524 TTTTTTCCACGGACTGGGGGTGG + Intergenic
1110909038 13:80932423-80932445 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114220528 14:20692656-20692678 GTATTTCTATGGATTGGTGGGGG - Intronic
1114977586 14:28121488-28121510 GTTTTTCAAGAGATGGGGTGGGG + Intergenic
1114978636 14:28133784-28133806 GTTTTTCTATGGACTGGGGGTGG + Intergenic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1116104345 14:40481226-40481248 GTTTTTATACATTTTGGGGATGG - Intergenic
1116255572 14:42549893-42549915 ATTTTTCCACAGACTGGTGGGGG - Intergenic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1117415407 14:55490885-55490907 TTTCTTGTAGAGATTGGGGGGGG + Intergenic
1118278806 14:64410394-64410416 TTTTTTGTAAAGATGGGGGGGGG + Intronic
1120177243 14:81307935-81307957 GATTTTCTACTGCTTGGGGGTGG + Intronic
1121013998 14:90537360-90537382 TTTTTTGTAGAGATGGGGGGGGG + Exonic
1122037140 14:98957140-98957162 GTTCATCTGCAGATTGTGGGGGG + Intergenic
1122139109 14:99651779-99651801 GTTTTTCAACAGATAGAGGCCGG + Intronic
1122170371 14:99869169-99869191 TTTTTTTTACAAATTGGTGGTGG + Intronic
1123795739 15:23767959-23767981 GATTTCCTACATATTGTGGGAGG + Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1125961692 15:43835313-43835335 CTTTTTATAGAGATTGGGGTGGG - Intronic
1126037985 15:44565330-44565352 ATTTTTCCACAGACTGGGAGGGG + Intronic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128430284 15:67586949-67586971 ATTTATCTACAGAGTTGGGGTGG + Intronic
1128805259 15:70526229-70526251 GTTTGTCTTCAAATAGGGGGAGG - Intergenic
1129688020 15:77697323-77697345 GATTTACTACAGGTTGAGGGTGG - Intronic
1129985126 15:79912333-79912355 ATTTTTCCACGGACTGGGGGTGG - Intronic
1131008442 15:88997588-88997610 GTTTTTACACAGAAAGGGGGTGG - Intergenic
1131892992 15:96994072-96994094 GTTTTTCTATGGACTGGGGTGGG + Intergenic
1132050305 15:98602210-98602232 GTTTTTCCACAGATGTGGTGTGG - Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1133818835 16:9218429-9218451 TTTTTTGTAGAGATTGGGGTTGG - Intergenic
1133909339 16:10050728-10050750 GTTTTTCCACAGACCGGGGTTGG - Intronic
1133968008 16:10545782-10545804 ATTTTTCTACAGACTGGGGAGGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1135527796 16:23227337-23227359 GTTTTGGTAAAGAGTGGGGGAGG + Intergenic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136225311 16:28856483-28856505 CATTATCTACAAATTGGGGGTGG + Intronic
1136291695 16:29276797-29276819 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1138967327 16:62100377-62100399 GATTTTGTACAGGTTGGGAGGGG + Intergenic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140375528 16:74442657-74442679 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1140523898 16:75606037-75606059 TGTTTTTTAGAGATTGGGGGGGG + Intronic
1140606616 16:76546686-76546708 GGTTTTCTACAGATGGGAGTGGG - Intronic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1141814115 16:86397793-86397815 ATGTGTCTACAGATTGGGTGGGG + Intergenic
1142097577 16:88250741-88250763 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1142178764 16:88657117-88657139 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1142513986 17:415053-415075 TTTTTTGTAGAGATTGGAGGGGG + Intronic
1144607417 17:16679072-16679094 GTTTTTGTAGAGATGGCGGGGGG + Intergenic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1146253956 17:31378110-31378132 CTTTCTCCACTGATTGGGGGAGG - Intronic
1146315972 17:31807087-31807109 ATTTTTCAATGGATTGGGGGTGG - Intergenic
1147454948 17:40531305-40531327 GCTTTTTGCCAGATTGGGGGTGG - Intergenic
1147662039 17:42121933-42121955 TTTTTTGTAGAGATTGGTGGGGG - Exonic
1148220988 17:45861654-45861676 GTTTTTCTAACGATTGGTAGGGG - Intergenic
1148479212 17:47949266-47949288 CTTTTATTACAGACTGGGGGCGG - Intergenic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1149363386 17:55916576-55916598 GTTTTGCTGCAGCTTGGGTGTGG + Intergenic
1149808107 17:59638540-59638562 ATTTTTCCACCGGTTGGGGGTGG + Intronic
1150532879 17:66003890-66003912 GTTTTTCCATGGATAGGGGGTGG - Intronic
1150806743 17:68325491-68325513 GTTTTTCCACAGACAGGGGTTGG - Intronic
1151088334 17:71406576-71406598 GTTTTTCTACAGATCGAGTCAGG + Intergenic
1151263619 17:72936727-72936749 ATTTTTCTACACATAGGAGGTGG + Intronic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1152761205 17:82107880-82107902 GCTTTTCTAAAGAAAGGGGGTGG + Intronic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1154384158 18:13878680-13878702 TTTTTTGTAAAGATGGGGGGCGG + Intergenic
1157679973 18:49597416-49597438 GGTTATCTATAGATTGGGGGTGG + Exonic
1157993163 18:52521646-52521668 ATTTGTCTTCAGTTTGGGGGAGG + Intronic
1158106701 18:53893573-53893595 GATTTTTTATAGATTGGGGGTGG - Intergenic
1159519324 18:69497367-69497389 GTGTTTCCAGAGATTGGGGCTGG - Intronic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160272775 18:77403222-77403244 CTGTTTCTTCAGATTTGGGGTGG - Intergenic
1160334259 18:78023490-78023512 ATTTTTCCACAGACTGGGAGCGG + Intergenic
1160886695 19:1353220-1353242 GTTTGTCTATAAAATGGGGGTGG - Intergenic
1161093043 19:2372503-2372525 TTTTTTCCAAAGACTGGGGGTGG - Intergenic
1161204461 19:3033838-3033860 CTTTTTGTAGAGATGGGGGGTGG - Intronic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161595035 19:5146760-5146782 TTTTTTGTAGAGATTGTGGGGGG - Intronic
1162630917 19:11926055-11926077 GTTTGTCTAAAGTTTGGAGGAGG + Intronic
1162635779 19:11965984-11966006 GTTTGTCTAAAGTTTGGAGGAGG + Intronic
1163277423 19:16294108-16294130 GTTTTTGTAGAGATGGGGGGAGG + Intergenic
1163623003 19:18371941-18371963 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1164579711 19:29427183-29427205 GTTTTTCCACAGACCAGGGGAGG - Intergenic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1164957775 19:32401952-32401974 TTTTTTGTAAAGATTGGGGGTGG - Intergenic
1165857005 19:38885271-38885293 ATTTTTGTAGAGATGGGGGGTGG + Intronic
1166582622 19:43915784-43915806 GTTTTTCCACAGACTGGGGTCGG - Intronic
1166767622 19:45261641-45261663 GTTTTACTGCAGACTGGGTGCGG + Intronic
1166857044 19:45787434-45787456 GTTTTTCCACAGACTGTTGGGGG - Intronic
1166940276 19:46358917-46358939 GTTTTTCTCAAGATGGGGAGTGG + Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167075658 19:47247235-47247257 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1168044258 19:53782733-53782755 GTTTATCTACAGACTTTGGGTGG - Intergenic
925180415 2:1813715-1813737 ATTTTTCTACAGAAAAGGGGTGG - Intronic
925530519 2:4855756-4855778 ATTTTTCTATAGATTGGGGTAGG - Intergenic
925744182 2:7030700-7030722 GTTTTTCCACAGACTGGGCAGGG + Intronic
925819607 2:7787150-7787172 GTTTCTCTTCAGATTGGTGGTGG + Intergenic
925891477 2:8438513-8438535 GTTTTTCCATAGACTGGGGGTGG - Intergenic
926046565 2:9714260-9714282 ATTTTTGTAGAGATTCGGGGTGG - Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927597344 2:24408245-24408267 GTTTTTCCACGGAATGGGGATGG + Intergenic
928675259 2:33644670-33644692 ATTTTTCCACAGACTGGGAGTGG - Intergenic
929417357 2:41756966-41756988 ATTTTTCCACAGACTGGAGGGGG + Intergenic
929524082 2:42683449-42683471 GTTTTTCCATGGACTGGGGGTGG + Intronic
930065237 2:47322842-47322864 TTTTTTGTAAAGATTGGCGGGGG - Intergenic
931377298 2:61718883-61718905 GTTTCTCCACAGACTGGGGTGGG - Intergenic
931605909 2:64051894-64051916 GTTTTTATACAGAAAGGTGGAGG - Intergenic
932245594 2:70193641-70193663 TTTTTTGTAGAGATTGGGGGTGG + Intronic
932770800 2:74499742-74499764 GTATTTCTACAGGCTGGGGCAGG + Intronic
933206799 2:79515476-79515498 GTTTTTCTGCAGAGTGGTGTGGG + Intronic
933627570 2:84619002-84619024 ATTTTGCTATAGATTGGGGTTGG - Intronic
933730603 2:85453316-85453338 TTTTTTGTTGAGATTGGGGGGGG + Intergenic
934964709 2:98710635-98710657 TTTTTAGTACAGATGGGGGGCGG + Intronic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG + Intergenic
936870188 2:117127594-117127616 TTTTTTCTGCTGATTGGGGTAGG - Intergenic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937850333 2:126626679-126626701 ATTTTTCCACAGACTGGGTGGGG + Intergenic
940453269 2:153867539-153867561 ATTTTTCCACAGACTGGGAGAGG + Intergenic
941784961 2:169488223-169488245 GTTTTTCCACGAATTGGGTGAGG + Intronic
941996682 2:171607798-171607820 TTTTTTTAAGAGATTGGGGGGGG - Intergenic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944260369 2:197669522-197669544 GTTTTTCTACAGATGTGGGTGGG + Intronic
944311637 2:198240151-198240173 ATTTTTCTACAGACAGGGTGGGG - Intronic
944397952 2:199290781-199290803 ATATTTCTGCAGATTGGGGAGGG - Intronic
944886153 2:204064638-204064660 ATTTTTCCACACACTGGGGGTGG - Intergenic
945629542 2:212256004-212256026 TTTTTTTTACAAATGGGGGGGGG + Intronic
946233465 2:218307217-218307239 GTTTTTCCAGGGACTGGGGGAGG + Intronic
946853854 2:223933782-223933804 TTTTTTGTAGAGATGGGGGGGGG - Intronic
946995005 2:225381476-225381498 ATTTTTCAACAGACTGGGGTGGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947334405 2:229067093-229067115 GTTCTTCTTCACATTGGGGCAGG + Intronic
948072927 2:235141928-235141950 GTCTTTCAACTGATTGGGTGGGG - Intergenic
948152215 2:235753204-235753226 CGTTTTCTTCAGGTTGGGGGTGG + Intronic
948734740 2:239994629-239994651 GTTTTTACACAGACTGGGGCGGG - Intronic
1169104254 20:2980676-2980698 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1170501988 20:16983288-16983310 ATTTTTCCACGGAGTGGGGGTGG - Intergenic
1170537758 20:17358131-17358153 TTTTTTGTAGAGATTAGGGGGGG - Intronic
1170685323 20:18564428-18564450 GTTTTTCCACAGAATGTAGGGGG + Intergenic
1170822642 20:19767378-19767400 GTTTTTACACAGAATGGTGGAGG + Intergenic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1173051958 20:39571866-39571888 GTTTTTCCACAGGTCGGGGTCGG + Intergenic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174635537 20:51996269-51996291 GTTTTTCCACAGACTGGGGTTGG + Intergenic
1174794803 20:53513073-53513095 TTTTTTGTAGAGATTGGGGGGGG - Intergenic
1178202423 21:30422637-30422659 GTTTTTCCACAGATTGGAGCAGG + Intronic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180713702 22:17857417-17857439 GTTTTTTCACAGACTGGGGTGGG - Intronic
1182635597 22:31724308-31724330 GTTTTTCCACAGATCTGGTGGGG - Intronic
1182729233 22:32474305-32474327 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1182926802 22:34132852-34132874 TTTTTTATAGAGATTGGTGGGGG + Intergenic
1183913794 22:41100050-41100072 TTTTTTCTAGAGATGGTGGGGGG - Intronic
1184284205 22:43459024-43459046 GTTTTTCATCAAATTTGGGGAGG + Intronic
1184521424 22:44996445-44996467 GTATTCCTCCAGACTGGGGGCGG + Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949800436 3:7898034-7898056 GTTTTTTCACAGGCTGGGGGTGG - Intergenic
949981400 3:9504020-9504042 TTTTTTTAAGAGATTGGGGGAGG - Intronic
951008124 3:17643111-17643133 GAATTCCCACAGATTGGGGGAGG - Intronic
951129525 3:19025265-19025287 GGGTTTCAACTGATTGGGGGAGG - Intergenic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951736425 3:25870338-25870360 GTTTATCTAAAAATTGGGGTAGG - Intronic
952166978 3:30760793-30760815 GTTTTTCTTCAGGTGGGGGCAGG + Intronic
952723849 3:36561221-36561243 GATTTTGTAGAGATTGGGGGAGG - Intergenic
952923138 3:38300988-38301010 GTTTTTTTAGAGATGGGGGTTGG + Intronic
953137667 3:40197090-40197112 GTTTTTCTATGGATTGCGGCAGG + Intronic
953874379 3:46657659-46657681 ATTTTTCCACAGACTAGGGGCGG - Intergenic
954318677 3:49815813-49815835 GCTTTTGTAGAGATTGGGGGTGG + Intergenic
954766080 3:52917812-52917834 GTTTTTCTACAGACTGGGGTGGG - Intronic
956089356 3:65649202-65649224 ATTTTTTTAGAGATTGGGGTGGG - Intronic
956717841 3:72093961-72093983 GTTTTTCTTCTGCTTTGGGGTGG - Intergenic
956877554 3:73478638-73478660 GTTTTTCCACGGACTGGGCGGGG - Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958849567 3:99307668-99307690 GTTTTTCCACAGACTGCAGGTGG - Intergenic
959848757 3:111063912-111063934 ATTTTTGTAGAGATGGGGGGGGG - Intergenic
960672910 3:120169344-120169366 GTTTTTCCACAGATAGTGGTGGG - Intronic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
961291265 3:125848645-125848667 ATTTTTTTAGAGATTGGGGCAGG + Intergenic
962181921 3:133214937-133214959 ATTTTTCTACAGACCTGGGGTGG - Intronic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
962808658 3:138944578-138944600 TTTTTTCTTCAGATAGGGAGAGG + Exonic
963176928 3:142308419-142308441 GTTTTTTTCCCGATTGGTGGAGG - Exonic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
963744817 3:149115504-149115526 GTTTTTCCACAGACTAGGGCAGG - Intergenic
963996247 3:151712406-151712428 TTATTTCAACAGATTTGGGGGGG - Intergenic
964816009 3:160718743-160718765 ATTTTTCTACGGACTGGGGTGGG + Intergenic
965971170 3:174558329-174558351 GTTTTTCCACAGACTGGGTACGG + Intronic
966163400 3:176991079-176991101 ATTTCTCCACAGACTGGGGGTGG + Intergenic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
966890435 3:184403762-184403784 TTTTTTGTAAAGATGGGGGGGGG + Intronic
967292906 3:187938869-187938891 TTTTTTGTACAGATGGTGGGGGG + Intergenic
968160323 3:196421596-196421618 TTTTTACTAGAGACTGGGGGGGG - Intronic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970254555 4:14154079-14154101 GTTTATCTCCAGATTGTGGTGGG - Intergenic
970430509 4:15984893-15984915 GTTTTTCCACAGGCCGGGGGTGG - Intronic
970514153 4:16810941-16810963 ATTTTTCCACAGACTGGTGGGGG + Intronic
970829042 4:20313665-20313687 GTTTTTCTATGGAATGGGTGGGG + Intronic
970892458 4:21062832-21062854 GGTTTTCAACAAATTGGAGGAGG + Intronic
971180969 4:24328254-24328276 GTTTTAATGCTGATTGGGGGGGG - Intergenic
971384921 4:26133738-26133760 ATTTTTCCATAGACTGGGGGCGG - Intergenic
972565014 4:40261800-40261822 GATTTCCTACAGGTAGGGGGTGG + Intergenic
972675090 4:41252316-41252338 ATTTTTCCACGGACTGGGGGTGG + Intergenic
972685467 4:41348469-41348491 GTTTTTGTAGAGATGGGTGGGGG + Intergenic
972957393 4:44409411-44409433 GTTTTTCTGCCTATTAGGGGAGG - Intronic
973095968 4:46200177-46200199 GTTTTTCCACAGATGTTGGGTGG - Intergenic
976413359 4:84742772-84742794 GTTTTTCCACAGACTAAGGGGGG - Intronic
976583410 4:86767098-86767120 TTTCTTGTAGAGATTGGGGGCGG + Intronic
977475962 4:97509960-97509982 ATTTTTCCACGGATTAGGGGTGG - Intronic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
977923585 4:102672852-102672874 GTTTTTCTACAGATTGGGGGTGG - Intronic
978072001 4:104484939-104484961 GATTTTCAAAATATTGGGGGAGG - Intronic
978754473 4:112287076-112287098 CTTTTTCCACAGACTGGGGTTGG + Intronic
979253909 4:118592365-118592387 TTTTTTCTAGAGATGGGGTGGGG + Intergenic
979335074 4:119453978-119454000 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
980026762 4:127777497-127777519 TTTTTTGCACAAATTGGGGGAGG + Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
981988720 4:150889675-150889697 GTTTTTCCACAAACTGGGGTTGG - Intronic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982782638 4:159507105-159507127 ATTTTTCTACAGGTTGGGTTGGG + Intergenic
982924628 4:161320331-161320353 ATTTTTCTACAGACTGGAGCGGG - Intergenic
983139078 4:164125916-164125938 GTTTTTCCACAGAATGGGGCAGG - Intronic
983346835 4:166537263-166537285 GTTTGCCTAGAGATTGGGGAGGG + Intergenic
983901178 4:173136084-173136106 GTTTTACTACATTTTGGGGGAGG - Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
985530012 5:428583-428605 ATTTTTCCACAGACTGGGAGTGG + Intronic
987945682 5:24605509-24605531 GTTTTTCTATGGATGGGAGGAGG - Intronic
988432099 5:31130906-31130928 ATCTTTCTAAAGTTTGGGGGAGG + Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
990972147 5:61519804-61519826 GTTTTTCCACGGATGGGGGGTGG + Intronic
991095027 5:62730965-62730987 GTTTTTCCACAGACCTGGGGTGG + Intergenic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992721013 5:79561209-79561231 GTCTTTCTAAAGAGTGGTGGTGG + Intergenic
992756227 5:79908985-79909007 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
992812368 5:80401615-80401637 GTTTTTCTAGAGACAGCGGGAGG - Intergenic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993770542 5:91919273-91919295 TTTTTTCCACAGACTGGGTGGGG + Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994323045 5:98415193-98415215 GTCTTTCTACAGATGAGGAGGGG + Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
995138263 5:108703758-108703780 GTTTTTCAACTGATTGGATGAGG - Intergenic
995225186 5:109692774-109692796 GTTTTTCCACAGACAGGGGTGGG + Intronic
995354429 5:111222715-111222737 TTTTTTCCACAGACAGGGGGTGG - Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996558603 5:124804258-124804280 GTTTTTCCACAGGTAGGGGGAGG - Intergenic
996559836 5:124816821-124816843 CTTTTTGTAGAGATAGGGGGTGG - Intergenic
997172517 5:131737936-131737958 ATTTTTCTGCAGACTGGGGCAGG + Intronic
997358442 5:133279405-133279427 GTTTTTCCACAGACTGGGAGTGG - Intronic
998201244 5:140124342-140124364 GTGTGTTTCCAGATTGGGGGGGG + Exonic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
1000727755 5:164792855-164792877 TTTTTTGTAGAGGTTGGGGGTGG - Intergenic
1000814137 5:165899484-165899506 GTTTTTCCACAGAACTGGGGAGG - Intergenic
1000958321 5:167569334-167569356 CTTTGTTTACAGATTGTGGGAGG + Intronic
1001758420 5:174188117-174188139 GTCTTTCTAAAAAATGGGGGAGG - Intronic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1002518316 5:179775350-179775372 GTTTTTAAACAGATTAGGGTAGG + Exonic
1002625787 5:180528008-180528030 AATTTTCCACAGATTTGGGGAGG - Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004562760 6:16766422-16766444 GTCTTGCTACAGTTTGGTGGAGG - Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005802511 6:29441032-29441054 GTCTTTCTTCACATTAGGGGAGG + Intronic
1005855191 6:29855634-29855656 ATTTCTCTACAGATTGTGGAAGG - Intergenic
1005976063 6:30800688-30800710 ATTCTTCTACAGCTTGGGAGTGG - Intergenic
1006507496 6:34498934-34498956 GTTTTTCCACAGACTGGGGTTGG + Intronic
1007828406 6:44619123-44619145 GTTTGTCTACAGCTTGTGGGAGG + Intergenic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008626143 6:53318559-53318581 GTTTTTGTAGAGATGGGGCGGGG - Intronic
1009052195 6:58289653-58289675 GTTTTTCCACAGACTGGGGTTGG + Intergenic
1012037618 6:94162906-94162928 ATTTTTCCATGGATTGGGGGTGG + Intergenic
1012973439 6:105755338-105755360 ATTTTTCCATAGACTGGGGGAGG - Intergenic
1012994970 6:105964034-105964056 ATTTTCCTAGAGATGGGGGGCGG + Intergenic
1013374823 6:109504182-109504204 GTTTTTATAGAGATTGGAGGGGG - Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1014102794 6:117530285-117530307 GTTTTTCCACAGACGGGGTGGGG + Intronic
1014403531 6:121020563-121020585 GTTTTCCTATAAATTGGGGTGGG + Intergenic
1014417423 6:121199150-121199172 GTATTTCTACAGATTTGTTGTGG + Intronic
1014905079 6:127016081-127016103 GTGCTTCTACAAGTTGGGGGAGG + Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015819579 6:137246025-137246047 GTTTTTCCACAGATGAGGGCAGG + Intergenic
1015897057 6:138027593-138027615 TTTTTTCTACACAATGGGGCAGG + Intergenic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1018490581 6:164288373-164288395 GTTTTTCTAGAGATTGGATCTGG - Intergenic
1018566603 6:165161551-165161573 GTTCTTCTACAGGTTCTGGGTGG - Intergenic
1019802576 7:3099256-3099278 TTTTTTCCACGGACTGGGGGTGG - Intergenic
1019985119 7:4650072-4650094 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1020867228 7:13581588-13581610 GTTTTTCTACAGATTAAAAGAGG - Intergenic
1021589459 7:22244705-22244727 GTTTTTCTACGGACTGGGGTAGG - Intronic
1024068980 7:45769710-45769732 TTTTTTCTAGAGATAGGGGGAGG + Intergenic
1024650838 7:51402125-51402147 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1024985650 7:55191363-55191385 GTTTATCTGCAAAGTGGGGGTGG - Intronic
1025054959 7:55757705-55757727 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025103595 7:56152953-56152975 GTTTATGGCCAGATTGGGGGGGG - Intergenic
1025133030 7:56387927-56387949 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1026106161 7:67422426-67422448 AATTTTCTACAGACTGGGAGGGG + Intergenic
1026191607 7:68133580-68133602 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1026212940 7:68323038-68323060 CTTTGTCTACAGATTTGGGATGG + Intergenic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1026399383 7:69993814-69993836 TTCTTTCTACAGATAGGGGAAGG + Intronic
1026420292 7:70229605-70229627 GTTTTTCATTAAATTGGGGGAGG + Intronic
1026823220 7:73563887-73563909 TTTTTTTTAGAGATGGGGGGGGG + Intergenic
1026957814 7:74388942-74388964 GTTTTTTTAGAGATTGGGTCTGG - Intronic
1027247851 7:76379563-76379585 TTTTTTGTAGAGATTGGGCGAGG + Intergenic
1027613554 7:80392804-80392826 TTTTTTCCACGGATTGGGGTGGG + Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1029347718 7:99990906-99990928 GTTTTTCCACGGACTGGGGAGGG - Intergenic
1029478245 7:100797947-100797969 GTTTTTGTAGAGATGGGGGCGGG + Intergenic
1029529976 7:101118869-101118891 TTTTTTGTAGAGGTTGGGGGGGG + Intergenic
1030272197 7:107681933-107681955 TTTTTTGTAGAGATTGGGGCGGG - Intronic
1031076561 7:117219131-117219153 GTTTCTGTACAGATTGGGTAAGG - Exonic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032062631 7:128737716-128737738 TTTTTTGTAGAGATAGGGGGAGG + Intergenic
1033026379 7:137777183-137777205 TTTTTTTAACAGATTGGTGGGGG - Intronic
1033954983 7:146835898-146835920 GAGTTTCTACAGGTTGGGGCAGG + Intronic
1034005360 7:147466368-147466390 GTTTTTACACAGAATGGTGGAGG + Intronic
1034007695 7:147492107-147492129 GTTTTTCTACAGACCAGGGTGGG + Intronic
1034055760 7:148033299-148033321 GTGTCTCTGGAGATTGGGGGTGG - Intronic
1034221555 7:149450441-149450463 GTTTTTCTGCTTACTGGGGGTGG - Intronic
1036396460 8:8375641-8375663 ATTTTTTTAAAGATTTGGGGAGG - Intronic
1036824030 8:11962468-11962490 TTTTTTATAGAGATGGGGGGAGG - Intergenic
1037299029 8:17432039-17432061 GCTTTTCTACAGAAGTGGGGAGG + Intergenic
1037603585 8:20419311-20419333 GTTTTTCCATGGATGGGGGGTGG + Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038879391 8:31591100-31591122 GTTTTTACTTAGATTGGGGGTGG + Intergenic
1039187328 8:34931822-34931844 ATTTTTCTACAGAAGGGGCGGGG + Intergenic
1040651182 8:49450562-49450584 CTTTTTCTATTGATTTGGGGTGG - Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1041860217 8:62504227-62504249 ATTTTTCCACAGACTGGTGGTGG - Intronic
1045472921 8:102528424-102528446 ATTTATCTACAGAATGGGGTGGG - Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1046846640 8:118923429-118923451 GTTTTTCAACAAATTGGTGCAGG + Intergenic
1047434918 8:124828270-124828292 GTTTTTGTAGAGATGGGTGGGGG + Intergenic
1051062771 9:13064310-13064332 GTAATTATACAGATTGGGGGTGG + Intergenic
1051332124 9:16033691-16033713 GTTTTTCCACAGACAGGGGGTGG - Intronic
1052842927 9:33308821-33308843 GTATTTCTACTGCTTGGAGGAGG + Intronic
1053221713 9:36318140-36318162 CTTATTCTACAGATTGGCTGGGG - Intergenic
1053728555 9:41028635-41028657 ATTTTTCCACAGACTCGGGGAGG + Intergenic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055354957 9:75428295-75428317 ATTTTTCCACAGACTGGGAGGGG - Intergenic
1056732795 9:89180257-89180279 GTTTCGCTACAGATCTGGGGAGG - Intergenic
1057306068 9:93912685-93912707 GGTTTTCTGCAGTTTGGGGTGGG + Intergenic
1058252670 9:102719901-102719923 GTTTTTTCACGGGTTGGGGGGGG - Intergenic
1058999281 9:110331634-110331656 TTTTTTCCCCAGACTGGGGGTGG + Intronic
1059255620 9:112928280-112928302 GTTTTTTGAGAGGTTGGGGGTGG + Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060476085 9:123987846-123987868 GCTTCTCTAAAGGTTGGGGGTGG + Intergenic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1061123486 9:128658899-128658921 GTTTTTGTAGAGATGGGGGCAGG + Intergenic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061494546 9:130964504-130964526 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1061675820 9:132215063-132215085 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1061723612 9:132569227-132569249 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1061797656 9:133097790-133097812 GTTTGTTTACTGATTGGGGAGGG - Exonic
1185789014 X:2914405-2914427 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1185811119 X:3111616-3111638 ATTTTTCTGCAGACTGGGGTGGG + Intronic
1185818157 X:3175711-3175733 TTTTTTGTAGAGATTGGGTGGGG + Intergenic
1186221712 X:7356169-7356191 ATTTTTCCACAAACTGGGGGTGG - Intergenic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187386241 X:18851340-18851362 GGTTTTCCACAGACTGGGGTGGG - Intergenic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1188283932 X:28305112-28305134 GTTTTTCCACAGATGTGGGAAGG + Intergenic
1188615411 X:32152255-32152277 GATTTTTTAAAGATGGGGGGTGG + Intronic
1189787702 X:44573975-44573997 TTTTTGGTAGAGATTGGGGGTGG + Intergenic
1190887990 X:54546030-54546052 ATTTTTGTAGAGATGGGGGGAGG + Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192477232 X:71453392-71453414 TTGTTTGTAGAGATTGGGGGTGG - Intronic
1194910435 X:99636018-99636040 GTTTTTCAACAAATTGTGTGGGG + Intergenic
1195451606 X:105020149-105020171 TTTTTTGTAGAGATTGGTGGGGG + Intronic
1195465825 X:105177483-105177505 ATTTTTCTAGGGATTGGGGGAGG - Intronic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1196084027 X:111664703-111664725 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197580680 X:128279432-128279454 ATTTTTCTAGTGATTGGAGGGGG - Intergenic
1198747436 X:139904561-139904583 GTTGTTCTACAGGTAGAGGGGGG + Intronic
1198761482 X:140037459-140037481 GTCTTTCCACAGATTGGATGAGG - Intergenic
1199135005 X:144238891-144238913 GTTTTTCTACAGATTACGGTAGG + Intergenic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic
1201326472 Y:12765687-12765709 ATTTTTCCACAGACTGGGTGGGG - Intronic
1201361299 Y:13152805-13152827 AGTTTTCCAGAGATTGGGGGGGG + Intergenic
1202297178 Y:23371871-23371893 ATTTTTCCACAGACTGGTGGAGG + Intergenic
1202573629 Y:26298726-26298748 ATTTTTCCACAGACTGGTGGAGG - Intergenic