ID: 977928671

View in Genome Browser
Species Human (GRCh38)
Location 4:102729106-102729128
Sequence CAGCTTGGACAGCTTGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 2, 1: 11, 2: 13, 3: 18, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977928660_977928671 16 Left 977928660 4:102729067-102729089 CCATGCCATGTCCTGCTTGGCCT 0: 1
1: 7
2: 17
3: 39
4: 366
Right 977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG 0: 2
1: 11
2: 13
3: 18
4: 123
977928666_977928671 -4 Left 977928666 4:102729087-102729109 CCTGCTGCAGGGCGGCCTCCAGC 0: 12
1: 16
2: 20
3: 49
4: 391
Right 977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG 0: 2
1: 11
2: 13
3: 18
4: 123
977928664_977928671 5 Left 977928664 4:102729078-102729100 CCTGCTTGGCCTGCTGCAGGGCG 0: 2
1: 15
2: 32
3: 33
4: 279
Right 977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG 0: 2
1: 11
2: 13
3: 18
4: 123
977928661_977928671 11 Left 977928661 4:102729072-102729094 CCATGTCCTGCTTGGCCTGCTGC 0: 3
1: 23
2: 19
3: 61
4: 458
Right 977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG 0: 2
1: 11
2: 13
3: 18
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977928671 Original CRISPR CAGCTTGGACAGCTTGGCGT TGG Intronic
903389459 1:22953760-22953782 CAGCTTGGCCAGGTCGGCGGCGG + Exonic
904956974 1:34292756-34292778 CACCTTGGACCTCTTGGTGTTGG + Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912430583 1:109626486-109626508 CAGCCTGGAGAGCTGGGGGTGGG + Intronic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915060310 1:153176380-153176402 CACCTTGGACAGGTGGGGGTAGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915973644 1:160371012-160371034 CAGCTTGCGCAGCTCGGCGAAGG - Exonic
922213131 1:223500518-223500540 CAGCTTGCACAGCTGGGAGCAGG - Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1067853519 10:49770092-49770114 GGGCTGGGACAGCTTGGCTTTGG + Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1073589455 10:104742615-104742637 GACCTTGGACAGCTGGGCCTGGG + Intronic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1074604070 10:114943037-114943059 TTGCTTGGACAGCTTGCCCTTGG + Intronic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1075653739 10:124147489-124147511 GAGCTTGGGGAGCTTGGGGTGGG - Intergenic
1076231571 10:128823769-128823791 CAGCAAGGGCAGCATGGCGTCGG + Intergenic
1076797536 10:132805552-132805574 CAGATTGGACAGCTTGTTGGGGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1079939047 11:26655140-26655162 CAGCCTGGAAAGCTGGGGGTGGG - Intronic
1082761513 11:57131297-57131319 CAGCCTGGACACCTTGGAGCAGG + Intergenic
1084271309 11:68030764-68030786 GGGCTTGGGCAGCGTGGCGTCGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090383947 11:126345752-126345774 CAGTGTGGACAGCGTGGCCTGGG + Intergenic
1091226217 11:133957710-133957732 CAACTTTGACTGCTTGGAGTCGG - Intergenic
1093997373 12:25656260-25656282 CAGCTTGGGCAACATGGCGAGGG + Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1102035407 12:109768315-109768337 CAGCTTGGTCCGCTTGCCCTCGG - Exonic
1102515471 12:113443348-113443370 CTGATTGGACAGCTTGGCTCCGG - Intergenic
1102883998 12:116508270-116508292 GAGCTTGCAGAGCTTGGCGTTGG - Intergenic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1112012065 13:95301099-95301121 CGGCGTGGACCGCGTGGCGTAGG + Intronic
1112753336 13:102604052-102604074 CAGTGTGAACAGCTGGGCGTGGG + Intronic
1114528825 14:23382530-23382552 GAACTTGGACAGGTTGGTGTTGG + Exonic
1114534421 14:23413861-23413883 GAACTTGGACAGGTTGGTGTTGG + Exonic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1120896190 14:89534563-89534585 CAGCTAGGGCAGTTTGCCGTAGG - Intronic
1122256697 14:100483400-100483422 CAGATTGGACAGGGTGGTGTGGG - Intronic
1122354839 14:101116636-101116658 GAGCTTGGAGTGCTTGGAGTGGG - Intergenic
1122425176 14:101601607-101601629 GAGCCTGGACAGCCTGGCGAGGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1132865418 16:2090674-2090696 CAGGATGGCCAGCTGGGCGTAGG + Exonic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1136713076 16:32255776-32255798 CATCTTGGACATCTTGGAGATGG + Exonic
1136754838 16:32673652-32673674 CATCTTGGACATCTTGGAGATGG - Exonic
1136813274 16:33196712-33196734 CATCTTGGACATCTTGGAGATGG + Exonic
1136819750 16:33306792-33306814 CATCTTGGACATCTTGGAGATGG + Intronic
1136826314 16:33363332-33363354 CATCTTGGACATCTTGGAGATGG + Exonic
1136831380 16:33462103-33462125 CATCTTGGACATCTTGGAGATGG + Exonic
1137613999 16:49836300-49836322 CAGCTTGGACAGGTTGGAGGTGG - Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141922971 16:87148382-87148404 CAGCTTTGCCAGCATGGAGTTGG + Intronic
1202991851 16_KI270728v1_random:19687-19709 CATCTTGGACATCTTGGAGATGG + Intergenic
1203056980 16_KI270728v1_random:933986-934008 CATCTTGGACATCTTGGAGATGG - Intergenic
1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG + Intronic
1147585437 17:41651632-41651654 GAGCTGGGACAGCTGGGCGAAGG + Intergenic
1152586240 17:81190680-81190702 CAGCGTGGCCAGCTCGGCCTTGG + Exonic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1159334358 18:67044018-67044040 CAGCATGGACAGCTATGGGTAGG - Intergenic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1160325407 18:77942430-77942452 CAGCTTGCACAGTTGGGTGTTGG + Intergenic
1161983414 19:7642060-7642082 CAGCTTGGCCAGGACGGCGTGGG - Exonic
1164867221 19:31614627-31614649 CATGTTGGACAGCTTGGCTCTGG + Intergenic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928606576 2:32948708-32948730 CTGCTTGGGCAGCTTTGGGTTGG + Intronic
933971192 2:87471169-87471191 CAGCTGGGACACCTGTGCGTGGG - Intergenic
935102083 2:100006653-100006675 GAACTTGGAGAGCTTGGCCTTGG + Exonic
936047807 2:109200641-109200663 CAGCTTGGCCAGGTAGGGGTGGG - Intronic
936322537 2:111479020-111479042 CAGCTGGGACACCTGTGCGTGGG + Intergenic
938112714 2:128579716-128579738 CAGGTTGGGCAGCTGGGCGATGG - Intergenic
938378626 2:130824340-130824362 GAGCTGGGACAGCTAGGCGCTGG - Intergenic
938758814 2:134405203-134405225 AAACTTGGACATCTTGGCCTGGG - Intronic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
949028218 2:241776054-241776076 CCGTGTGGAGAGCTTGGCGTCGG + Intergenic
1169190143 20:3653542-3653564 CAGCTTCGACTGCATGGCCTGGG + Intergenic
1170817058 20:19722314-19722336 CAGCTGGGCCGGCTTGGCGGAGG - Exonic
1170874769 20:20240274-20240296 CAGCTTGGGAAGCTTGGCTAGGG + Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1175543241 20:59761381-59761403 CAGCTTGGGCAGCTGGCTGTGGG - Intronic
1175869357 20:62200911-62200933 GAGCTGGGACAGATTGGCTTGGG - Exonic
1176150649 20:63589082-63589104 CAGCTTGGGCTGCTTGGCCACGG - Exonic
1178693001 21:34765317-34765339 CAGCTTTGACAGCATGTCATGGG + Intergenic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1182808976 22:33099674-33099696 GGGCTTGGACAGCTTGAAGTTGG + Intergenic
949326494 3:2871103-2871125 CTGCCTGGACTGCTTGGCTTCGG - Intronic
950424754 3:12919125-12919147 CTGCTTGGACACCTGGGCCTGGG + Intronic
950628376 3:14265091-14265113 CAGCTGTGACAGGTTGGCGGGGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953192578 3:40701472-40701494 CTGCTTGGTGAGCTTGGCTTTGG + Intergenic
953690098 3:45110606-45110628 CAGCTTGAACACCTCGGGGTTGG + Exonic
953715009 3:45309981-45310003 CAGCTTGGACAGTGTGGCACTGG - Intergenic
954326244 3:49865838-49865860 CAGCTTTGCCAGTGTGGCGTGGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
958916776 3:100058931-100058953 CAGTTTGGACAGCATGGAGAAGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963437794 3:145293709-145293731 CAGCTTGGACTCATTGGCTTTGG - Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
968447042 4:657394-657416 CAGCTTGTTCATCTTGTCGTAGG - Exonic
976612857 4:87047548-87047570 CAGTTTGGTGAGCTTGGCTTTGG - Exonic
976752330 4:88462164-88462186 CTGCATGGGCAGCTTGGAGTTGG + Exonic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
987118485 5:14744962-14744984 CAGAATGGGCAGCTTGGCCTTGG - Intronic
988488050 5:31683127-31683149 CAACTTTTACAGCTTGGCTTTGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
992191533 5:74296715-74296737 CAGATTGAACAGTTTGGGGTGGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999453215 5:151694023-151694045 CAGTGTGGACAGCTAGGCCTGGG + Intergenic
999731152 5:154477610-154477632 GATCTTGGAGAGCTTGGTGTCGG + Exonic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1007733903 6:43968526-43968548 CAGCTTGGTCAGGCTGGCCTGGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1016785297 6:148004859-148004881 TGGCTTAGACAGCTTGGAGTAGG - Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1019743696 7:2688213-2688235 CAGCGTGGGCAGCTCGGCCTGGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1029400802 7:100344654-100344676 CAGCTTGTCCAGCCTGGCCTGGG - Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1031899247 7:127392116-127392138 CCGCGGGGACAGCCTGGCGTGGG + Intronic
1032884109 7:136119410-136119432 CAGCTTGCACAGCTTGCCTGTGG + Intergenic
1033648401 7:143322036-143322058 CAGCTTGGGGAGCTTGGAGCAGG + Intronic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1052169856 9:25379727-25379749 CACCTTGGACAGCTTGGTAAAGG + Intergenic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1052963276 9:34318945-34318967 GACCTTGGGCAGCTTGCCGTCGG - Intronic
1056094249 9:83234737-83234759 AAGATTGGAAAGCTTGGAGTAGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1060028101 9:120190183-120190205 CATGTTGGACAGCTGGGGGTGGG - Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1187063889 X:15814252-15814274 CAGCCTGGTCAGCTTAGCCTTGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1191810785 X:65186087-65186109 CACCTTGGGTAGCTTGGAGTTGG + Intergenic
1192221077 X:69197735-69197757 CAGCTTGGGCTGCCTGGCCTGGG - Intergenic