ID: 977932633

View in Genome Browser
Species Human (GRCh38)
Location 4:102765154-102765176
Sequence GCGTATTAGTAGATGGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977932631_977932633 -2 Left 977932631 4:102765133-102765155 CCATAACAGAAATGAAGAATGGC No data
Right 977932633 4:102765154-102765176 GCGTATTAGTAGATGGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977932633 Original CRISPR GCGTATTAGTAGATGGAACA CGG Intergenic
No off target data available for this crispr