ID: 977937490

View in Genome Browser
Species Human (GRCh38)
Location 4:102824033-102824055
Sequence TGTCCACTCACTAAAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977937485_977937490 28 Left 977937485 4:102823982-102824004 CCCATATTTCTAGAAGAGGTGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 124
977937484_977937490 29 Left 977937484 4:102823981-102824003 CCCCATATTTCTAGAAGAGGTGC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 124
977937486_977937490 27 Left 977937486 4:102823983-102824005 CCATATTTCTAGAAGAGGTGCCT 0: 1
1: 0
2: 0
3: 13
4: 142
Right 977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 124
977937487_977937490 7 Left 977937487 4:102824003-102824025 CCTAAACCGAAGAGCATTCCAGT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 124
977937488_977937490 1 Left 977937488 4:102824009-102824031 CCGAAGAGCATTCCAGTTCAGAG 0: 1
1: 0
2: 1
3: 15
4: 155
Right 977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977937490 Original CRISPR TGTCCACTCACTAAAATTGT TGG Intronic
900944678 1:5823215-5823237 TGTCTTCTCTCTAAAGTTGTGGG - Intergenic
905207003 1:36348620-36348642 AGTCCACTCAGCAAATTTGTGGG - Intronic
905976768 1:42181195-42181217 TGGCCACTCACTAAACTGGGTGG + Intronic
907766373 1:57415700-57415722 TGTCTACTCACGAAAGTTCTAGG - Intronic
909532905 1:76700727-76700749 TCTCCACTTACTATAATGGTTGG + Intergenic
910498843 1:87865291-87865313 TGTCCAACCACTAAAATTTGGGG - Intergenic
911246543 1:95524690-95524712 TCTCAACTGACTAAAATTGGGGG + Intergenic
917529051 1:175816655-175816677 TGTACATTGAATAAAATTGTTGG + Intergenic
918870805 1:189971540-189971562 TGTCATCTCATTAAAATTGGGGG - Intergenic
922045602 1:221942658-221942680 TGTTCACTCACTGTAATGGTGGG + Intergenic
922285718 1:224168883-224168905 TCTCCACTCATTCATATTGTTGG + Intergenic
924035688 1:239934251-239934273 TGTTCAGCCACTAAATTTGTGGG - Intergenic
1063943442 10:11154623-11154645 TGTCCAGACAGGAAAATTGTAGG + Intronic
1063980778 10:11450045-11450067 TGTCCTCTCGCTTAAGTTGTGGG + Intergenic
1067780464 10:49199808-49199830 GGTACACTCACTAAAATATTTGG + Intergenic
1067955896 10:50790149-50790171 TGTATTCTCACTAAAATTGTAGG + Intronic
1069284869 10:66701014-66701036 TGTACACTCACTTGAAATGTGGG - Intronic
1072853423 10:98921616-98921638 GCTCCAGTCACTAAAATTGGGGG - Intronic
1073791441 10:106944059-106944081 TTTCCACTCTCTAAAAAGGTTGG + Intronic
1080270677 11:30447980-30448002 TGTAAACTCCCTGAAATTGTAGG - Intronic
1085562434 11:77484669-77484691 TGACCAGTCACTAACTTTGTGGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092247250 12:6870572-6870594 TCTCCACTTACTATAATGGTTGG + Exonic
1092763595 12:11831616-11831638 TTGACACTCAGTAAAATTGTAGG - Intronic
1097463676 12:59895556-59895578 TTTGCACAAACTAAAATTGTTGG - Intergenic
1100505167 12:95212922-95212944 TGTCCTCTCACTCAATTTCTAGG + Intronic
1101713769 12:107292700-107292722 TGTCCAGTCACTGAAATTTTGGG + Intergenic
1106385604 13:29282422-29282444 TGTCCAGTCACTAGCTTTGTGGG - Intronic
1107811069 13:44200184-44200206 TGTTTACTGACTAAAAGTGTGGG - Intergenic
1108755226 13:53492986-53493008 TATCCACTCATTACAAGTGTTGG - Intergenic
1112137968 13:96604270-96604292 TTTCCACTCAGTAAAAATGATGG - Intronic
1114436897 14:22714119-22714141 TGTACACTCACTGCAATTTTGGG - Intergenic
1117906425 14:60593315-60593337 TGCACACTCACTAAAATGGTTGG + Intergenic
1124699322 15:31898300-31898322 TGAACAGACACTAAAATTGTGGG - Intergenic
1126718276 15:51546905-51546927 TGTCCAGCCAATGAAATTGTTGG - Intronic
1127286092 15:57535008-57535030 TGGCCATTCACTAATATTGCTGG - Intronic
1128805731 15:70529687-70529709 TGTCCACTCACTAATGATGAAGG - Intergenic
1133649758 16:7800665-7800687 TTTCCACTCACAAAAATCGCAGG + Intergenic
1134683731 16:16144418-16144440 TGTCCCCTGATTGAAATTGTTGG + Intergenic
1139653823 16:68375709-68375731 TGGCCACTCACTACCATTGCTGG - Intronic
1141794541 16:86261828-86261850 TGTTCAGTCACTAAAATGTTGGG + Intergenic
1144080165 17:11757222-11757244 TGTGCACTTAAAAAAATTGTTGG + Intronic
1148448184 17:47754074-47754096 TCTCTACACACTAACATTGTGGG - Intergenic
1148617314 17:49010811-49010833 AGTCCACGCACTAAAATGGGAGG + Intronic
1149939864 17:60852303-60852325 TGTCCACTCTGTAACATCGTTGG + Intronic
1155164138 18:23218976-23218998 TGTACATTTACTATAATTGTGGG - Intronic
1159130880 18:64278912-64278934 TGCCCACTTACAAAAATTGTGGG + Intergenic
927226919 2:20776091-20776113 TGTTCAGTCACTCAAATTTTAGG - Intronic
927499076 2:23570387-23570409 TGTCCCTTGACTTAAATTGTTGG + Intronic
928348851 2:30527519-30527541 TGTCCAGTCACTCTAATTTTTGG + Intronic
928723465 2:34146168-34146190 TTTTAATTCACTAAAATTGTTGG - Intergenic
932840001 2:75073283-75073305 TGTCCACACACAAAAGATGTGGG - Intronic
933242518 2:79938518-79938540 GGTTCACTCTCTAAAAATGTTGG - Intronic
936893675 2:117402145-117402167 TTTCCACTCACTGAAATTATAGG + Intergenic
937514290 2:122635982-122636004 TGTCCACTCACATAACTTGGTGG - Intergenic
940653280 2:156458426-156458448 TGTGCAATAACTAAAAATGTAGG + Intronic
945194480 2:207225498-207225520 TGTCCTTTCACTAATATTGCCGG + Intergenic
945296841 2:208179118-208179140 TGTTCATTCAGTATAATTGTAGG - Intronic
945801624 2:214439161-214439183 TGTCTTCTCAATAAAATTATTGG - Intronic
946109536 2:217402420-217402442 TGGCCACTCTCTTACATTGTAGG - Intronic
1173026582 20:39313002-39313024 TGTCCACTGTCCAACATTGTGGG + Intergenic
1173853934 20:46237650-46237672 AGTCCACTCAGGAAAAATGTCGG - Intronic
1176378927 21:6102069-6102091 TGTCCACACTCCAAAAATGTGGG + Intergenic
1179744547 21:43436168-43436190 TGTCCACACTCCAAAAATGTGGG - Intergenic
1182215092 22:28709496-28709518 TGTTCACTCAGTAACATTTTGGG + Intronic
1182822486 22:33229749-33229771 TTTCCACTCAGAAAAATTATTGG - Intronic
949288587 3:2436167-2436189 TATGCACTCAATAAAAATGTTGG - Intronic
951460274 3:22944447-22944469 TCTACACTCACTCAGATTGTTGG + Intergenic
956045596 3:65192634-65192656 TGTCCTTTCACTAAAATGTTTGG - Intergenic
956188527 3:66585444-66585466 TGGCCGCTCCCTAAAATTATGGG + Intergenic
957534303 3:81481478-81481500 TGTCCAGTCATTAAGATTTTAGG + Intergenic
957678510 3:83402117-83402139 TATCCATTCACTTAAATTGCAGG - Intergenic
959532063 3:107444759-107444781 TTCACACTTACTAAAATTGTTGG - Intergenic
960374008 3:116876501-116876523 TATCCACAGACTAAAATTATTGG + Intronic
960965532 3:123101788-123101810 TGTCCACCCACTAAGCTTCTGGG + Intronic
961805265 3:129484803-129484825 TGTAGACTCACATAAATTGTAGG + Intronic
967463948 3:189780636-189780658 TTTCCACTCACTCTAAGTGTGGG - Intronic
970805033 4:20021154-20021176 TATACAGTCACTAAAATTGAAGG - Intergenic
973003505 4:44981769-44981791 TGTCCACTCAAAAAAAATTTTGG - Intergenic
973028050 4:45299138-45299160 TTTCCACTCTTGAAAATTGTTGG + Intergenic
977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG + Intronic
978423388 4:108557632-108557654 TGTCTACTCTATAAAACTGTAGG + Intergenic
980788730 4:137589995-137590017 TGGACACTTACTAAAATGGTAGG + Intergenic
981284691 4:143002825-143002847 TTTCCAGTCTCTAAATTTGTTGG - Intergenic
982472454 4:155809384-155809406 TAACCACTCACTAGAGTTGTTGG + Intergenic
985092578 4:186379353-186379375 TGGTTACTCCCTAAAATTGTTGG - Intergenic
986926847 5:12765181-12765203 TGTTCATTCTGTAAAATTGTGGG - Intergenic
987922696 5:24304366-24304388 TTATCACTCACTAAAATTATTGG - Intergenic
988599687 5:32628144-32628166 TGTCCACTCAACAAGCTTGTAGG + Intergenic
988973886 5:36496078-36496100 TTTCCACTCACGTAAAATGTAGG + Intergenic
996647784 5:125837771-125837793 TGTTCAATAACTAAAATAGTAGG + Intergenic
1000576973 5:162986877-162986899 TGTGCACTCCCTAAAAGTATAGG + Intergenic
1000751854 5:165105541-165105563 TATCCAATCAATAAAATCGTTGG - Intergenic
1006253621 6:32811847-32811869 TTTTCACTCACCAAAAATGTAGG + Intergenic
1008321347 6:50118045-50118067 TGTTCTCTTACTATAATTGTGGG - Intergenic
1012635023 6:101527057-101527079 TGTCCACTCTCTGAAAGGGTAGG - Intronic
1014668881 6:124273957-124273979 TTTCCACTGAGTAAAATTATAGG + Intronic
1016772654 6:147869493-147869515 TGTCCACTCACTGAGCATGTTGG - Intergenic
1024395731 7:48864644-48864666 TGTGCAATCACTAAGAATGTGGG + Intergenic
1024399503 7:48907632-48907654 TGTGCAATCACTAAGAATGTGGG - Intergenic
1024407089 7:48994139-48994161 TTTTCACTCCCAAAAATTGTTGG - Intergenic
1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG + Intergenic
1027806424 7:82830747-82830769 TGTACTATCACTAAAATTCTGGG + Intronic
1028442231 7:90876939-90876961 TGTCCATTCAATAACATTTTAGG + Intronic
1032108775 7:129056959-129056981 TCTCCACTTACTGTAATTGTTGG + Intergenic
1033605822 7:142928004-142928026 TGTCCACTTACTAAGATCCTGGG - Intronic
1034294603 7:149960984-149961006 TGTACACTCACAGAAAGTGTGGG + Intergenic
1034811354 7:154134785-154134807 TGTACACTCACAAGAAGTGTGGG - Intronic
1034811454 7:154135870-154135892 TGTACACTCACAGAAAGTGTGGG - Intronic
1038055333 8:23852643-23852665 TCTCCAGACACCAAAATTGTAGG - Intronic
1039108624 8:34017804-34017826 TGTCCAGACCCTAAAAGTGTTGG - Intergenic
1042715508 8:71768323-71768345 TTTCCATTCACAAAAATGGTGGG - Intergenic
1045406302 8:101869763-101869785 TGTGCAATGACCAAAATTGTAGG + Intronic
1049129433 8:140824480-140824502 TCTCCACCAACTAAAACTGTTGG + Intronic
1050982670 9:12039873-12039895 TGACCATTCAATAAAATTTTGGG - Intergenic
1052410966 9:28120547-28120569 TGTAGACCTACTAAAATTGTGGG - Intronic
1054934560 9:70672897-70672919 TGTCTACTTCCTAAAATTCTCGG - Intronic
1055991932 9:82115743-82115765 TGTCGACTCTCAAAAATGGTCGG - Intergenic
1058014177 9:100011262-100011284 TGGCCAAACACTCAAATTGTAGG + Intronic
1186130389 X:6459360-6459382 TGTCCACACACTCTAACTGTAGG + Intergenic
1187456031 X:19442012-19442034 TGTGAAGTCACTGAAATTGTGGG + Intronic
1188008863 X:25037795-25037817 TGCCCACTCACTAAGGTTCTAGG - Intergenic
1193882471 X:86940372-86940394 TGTATACTCAATAAATTTGTGGG - Intergenic
1195208833 X:102630833-102630855 TTTCCAGTCTCTAAAATTATGGG + Intergenic
1196021112 X:110992086-110992108 TGACCACCCTCTAAAATTATAGG - Intronic
1196114017 X:111978568-111978590 TGTCCATACAAAAAAATTGTTGG + Intronic
1198809833 X:140524209-140524231 TATCCACTCAGTAAGATGGTGGG - Intergenic
1199349631 X:146785920-146785942 TTCCTACTCAATAAAATTGTTGG + Intergenic
1201897704 Y:19010372-19010394 TGTCCATTCAGTCAAATTGATGG - Intergenic
1201925718 Y:19285472-19285494 TGTCCATTGAATAAAATGGTGGG + Intergenic