ID: 977945773

View in Genome Browser
Species Human (GRCh38)
Location 4:102912376-102912398
Sequence CTGCTTTTGGTGAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 6, 1: 0, 2: 3, 3: 28, 4: 398}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977945771_977945773 24 Left 977945771 4:102912329-102912351 CCTAGAAACATTCAAGGGTCAAT 0: 1
1: 7
2: 2
3: 10
4: 149
Right 977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG 0: 6
1: 0
2: 3
3: 28
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977945773 Original CRISPR CTGCTTTTGGTGAAGAAAAA AGG Intronic
900384424 1:2403185-2403207 CTACTTTATGTGAAGAAAAAAGG - Exonic
904235986 1:29117560-29117582 CTGCTTCTGATGAGGTAAAAGGG - Exonic
904453073 1:30628971-30628993 CTGAGTTTGGATAAGAAAAACGG + Intergenic
904961174 1:34334214-34334236 CTGCTATTGGAGAAGAAATATGG - Intergenic
905618604 1:39420325-39420347 CTGCTTTTGGTACAATAAAATGG - Intronic
906569330 1:46822766-46822788 GTGCTGTTGGTGAAGCATAATGG - Intergenic
907006140 1:50915911-50915933 CAGCTTTAGGGGAAAAAAAAAGG - Intronic
907904273 1:58770038-58770060 CTGCATTTTGTAAAGAAAACAGG - Intergenic
908587071 1:65581357-65581379 CTGCTTTTCATGAAGAAGAGAGG - Intronic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
909827863 1:80148240-80148262 CCGATTTTTGTGAAGAACAAGGG + Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
911214448 1:95177068-95177090 CAGCTTTTAGTGAAAAAATAAGG - Intronic
912531475 1:110326909-110326931 TTTCTTTTTCTGAAGAAAAAGGG + Intergenic
915499329 1:156304013-156304035 CTCATTTTGCTGGAGAAAAAAGG + Intergenic
915768748 1:158395432-158395454 ATTGTTTTGGGGAAGAAAAAGGG + Intergenic
916544963 1:165795315-165795337 CTGCCTTTGGGGAGGAACAATGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917549814 1:176014069-176014091 ATGTTTTTGGTGGAGAATAAAGG + Intronic
918304814 1:183236217-183236239 TTGCTTTTGTTAAAAAAAAAGGG + Intronic
918416510 1:184314106-184314128 CTAATTTTGGGCAAGAAAAAAGG - Intergenic
919462987 1:197901170-197901192 CTTCTTTTGGTGAAGATGAGAGG - Intergenic
919615095 1:199796966-199796988 CTGCTTGTGGGGAAGTAAATTGG - Intergenic
919980230 1:202638293-202638315 CAGCATGTGGTGAAGAAAAATGG + Intronic
922145957 1:222944643-222944665 TTGCTTCTGGTGAAGACAGAGGG - Intronic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922318977 1:224467973-224467995 CTGATTTTTTTAAAGAAAAAAGG - Intronic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
922923002 1:229324013-229324035 TTGCTTTGGGGGTAGAAAAATGG - Exonic
923054269 1:230413796-230413818 CTCCTGGTGGTGAAGACAAACGG - Intronic
924047097 1:240042861-240042883 CTGCTTTTGGTGAAGAACTCAGG + Intronic
1063006217 10:1973001-1973023 CTGCTGTGGGGGAAGAATAATGG + Intergenic
1063107224 10:3002971-3002993 TTGCTTGTGGGGAAGTAAAATGG + Intergenic
1063579438 10:7292253-7292275 CTGACTTTGCTAAAGAAAAAAGG + Intronic
1064180213 10:13108317-13108339 GTGTTTTTGGTTAAGAAGAAAGG - Intronic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064542401 10:16418223-16418245 CTCCTTTGGGTGAAAAGAAATGG + Intergenic
1064887215 10:20123969-20123991 CTGCTAAGGGTGAAGAAGAAGGG + Intronic
1066112946 10:32213251-32213273 CTGGTTTTGGAGGAGGAAAAGGG + Intergenic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067790676 10:49285056-49285078 CTGCTGGTGGGGATGAAAAATGG + Intergenic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068714321 10:60171391-60171413 CTGCTTTTTGTGAAAAACATGGG - Intronic
1069654602 10:70078455-70078477 CTGCCTTTGGGGGAGAGAAAGGG - Intronic
1069765112 10:70850789-70850811 CTACTTTTTGTGCAAAAAAAGGG + Intronic
1069955309 10:72047016-72047038 CTGAATTTGGTGTAGATAAAAGG - Intergenic
1070195554 10:74153081-74153103 CTGGTTTTGGTTAAGGAGAATGG + Intronic
1071247348 10:83779406-83779428 CATCTTTTTGTGAAAAAAAATGG + Intergenic
1071509538 10:86252624-86252646 GTGTCTTTGGTGTAGAAAAATGG - Intronic
1071998093 10:91166210-91166232 CTGCTATAGGTGGAGAAGAATGG + Intronic
1073710083 10:106026844-106026866 CTCCTCTTGGGGAAGAAAATGGG - Intergenic
1073727740 10:106253833-106253855 GTGCTGTTGGGGAAGATAAAAGG - Intergenic
1075178991 10:120193159-120193181 CTGATGTGGGTGCAGAAAAAAGG - Intergenic
1075305609 10:121365115-121365137 CTGCTTTTGGTTCAGGAAATCGG - Intergenic
1078058089 11:8023748-8023770 CTGATTGTGATGAAGATAAAAGG + Intronic
1078986500 11:16604306-16604328 GTGGGTTTGGTGAATAAAAAAGG - Intronic
1079171548 11:18101170-18101192 CTGCTTGTGGTTATGTAAAATGG + Intronic
1079193418 11:18302065-18302087 CTGCTTGGGGTTAAGAAAATGGG - Intronic
1079290304 11:19182205-19182227 CTGCTAATGGAGAAGAAAACAGG - Exonic
1080428952 11:32181215-32181237 CTGCTTTTGTAAAAGGAAAAAGG + Intergenic
1080473561 11:32569631-32569653 TTGCTTTTGGAAAAAAAAAATGG + Intergenic
1080763946 11:35278573-35278595 CTGCTGTTGGTGCAGACAACAGG - Intronic
1081245409 11:40760319-40760341 CTGCTCTTCGTGCCGAAAAAGGG + Intronic
1082962964 11:58936605-58936627 CTGAATTTGGGGTAGAAAAATGG + Intronic
1082976589 11:59078696-59078718 CTAAATTTGGTGTAGAAAAATGG + Intergenic
1088059165 11:105624709-105624731 ATGTTTTTGGGGAGGAAAAAAGG - Intronic
1088299336 11:108339176-108339198 ATAGTTTTGGTGGAGAAAAATGG - Intronic
1089032999 11:115353139-115353161 GTGTTTTTGTTCAAGAAAAACGG + Intronic
1089982843 11:122786776-122786798 CTGCTTTTGGTGAGTGAGAAAGG + Intronic
1092017082 12:5168484-5168506 CTGCCATTGGTGAATAAAAGAGG - Intergenic
1092573920 12:9758061-9758083 CTGCTTGTTGGGAAAAAAAAAGG - Intronic
1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG + Intronic
1093489206 12:19685581-19685603 CTGCTTTTGGGGAATAAACATGG - Intronic
1093873734 12:24324314-24324336 TTGCCTTTGGTGAAAAGAAATGG + Intergenic
1095136808 12:38614983-38615005 CTGGTTTTGATGATGGAAAAGGG - Intergenic
1095264473 12:40138010-40138032 CAGCTTTAGGTGAACAAACAGGG + Intergenic
1095285073 12:40401118-40401140 CTGCCTTAAGTGAATAAAAATGG + Intronic
1095312948 12:40722320-40722342 CAGTTTTTGCTGAAGAAATATGG + Intronic
1095755102 12:45756258-45756280 GTGCATGTGGTTAAGAAAAAGGG + Intronic
1096442295 12:51653765-51653787 CTGCTGGTGGTAAAGGAAAATGG - Intronic
1096675258 12:53222607-53222629 GTGCATCTGGTGAAGAGAAACGG - Intronic
1096907936 12:54952933-54952955 TTGTGTTTGGGGAAGAAAAATGG - Intronic
1097086471 12:56472052-56472074 GTACTTTTGGTGAAAAAGAAAGG + Exonic
1097370302 12:58770662-58770684 CTGTTTTTGGTGTATAGAAATGG - Intronic
1097851141 12:64411538-64411560 CTGCTTTTTGTCAGTAAAAATGG + Intronic
1098162082 12:67655478-67655500 CTGCTTTTGGCATAGAACAAGGG + Intronic
1098424857 12:70351114-70351136 TTGCTTTTAGTGGAAAAAAAAGG - Intronic
1099566124 12:84248719-84248741 CTGTTGTTGGAAAAGAAAAAAGG - Intergenic
1099920942 12:88956454-88956476 ATCCCTTTGGGGAAGAAAAAGGG + Intergenic
1100938496 12:99697954-99697976 ATGCTTTTGATTAAGAAAAACGG + Intronic
1101023878 12:100581653-100581675 GTTCTTTTGTTGGAGAAAAATGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101482715 12:105116610-105116632 CTGCTTTTGCTACAAAAAAATGG + Intronic
1103841283 12:123867213-123867235 ATGCCCTTGGGGAAGAAAAAGGG - Intronic
1104354964 12:128077284-128077306 CTGCTTCTGGTGAAGACGTAAGG + Intergenic
1105486840 13:20841596-20841618 CTGCTTTTGGGAAAGAAACCTGG + Intronic
1109661057 13:65461339-65461361 CTACCTTTGGTGAAGTAAAGTGG - Intergenic
1109880272 13:68464542-68464564 CTCCTTTTGGAGATGTAAAAGGG - Intergenic
1110733233 13:78905378-78905400 ATGCTTATGGTGAAGATACAAGG + Intergenic
1112628213 13:101130152-101130174 GTGCTCTTTGTGGAGAAAAAAGG - Intronic
1112833628 13:103485527-103485549 CTACTTCTGGTAAAGAAAGAAGG - Intergenic
1112956565 13:105066324-105066346 CTTGTTTTGGAGAAGAAAAGGGG - Intergenic
1113014525 13:105813280-105813302 TTCCTTTTGGTTAAAAAAAATGG + Intergenic
1113029062 13:105974167-105974189 TTGCTTTTGTTCAAGAAGAATGG - Intergenic
1115057821 14:29152209-29152231 CTGCATTTAGTGAAATAAAAGGG - Intergenic
1115715133 14:36095039-36095061 CTCCTTTTGTTGAAAAATAAAGG - Intergenic
1115805367 14:37044994-37045016 TTTCTTTTGGAGATGAAAAAGGG + Intronic
1116928310 14:50664688-50664710 CTACTTTTTGTTGAGAAAAAGGG + Intronic
1117938777 14:60938030-60938052 CTGTTATTGGTGTAGAAGAATGG + Intronic
1118364716 14:65084887-65084909 CAGCTTTTGGGGAGAAAAAAAGG + Intronic
1118682339 14:68255808-68255830 ATGTTTTTAGTGTAGAAAAATGG - Intronic
1118971815 14:70643257-70643279 CTGCTAGGGGTGAAGGAAAAGGG + Intronic
1121003619 14:90471526-90471548 CTGCTTATGATGAATGAAAAAGG - Intergenic
1121592862 14:95131910-95131932 CTGATTTTATTGAAGAAAACAGG - Intronic
1121619771 14:95338012-95338034 CTGGTTTTGGAGAAAAAATAAGG - Intergenic
1121779045 14:96609970-96609992 CTGCATTTGTTAAACAAAAATGG - Intergenic
1124950286 15:34312337-34312359 ATGTGTTTGGTGAATAAAAAAGG + Intronic
1125646825 15:41279543-41279565 CTGCCTTTGGTGTATAAACAGGG + Exonic
1126226857 15:46280845-46280867 GTGCTTTTGGTGAAGAGTAGAGG + Intergenic
1126673041 15:51133872-51133894 CTGCTTTTGTTTAATAATAAGGG - Intergenic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1128611794 15:69079831-69079853 TTGCTTTTAGGGAAGAAAATTGG - Intergenic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1129020875 15:72516817-72516839 CTGCTTGTGGTGAAGTAAAGTGG + Intronic
1130527723 15:84721627-84721649 CTGCTTTAGCTGAAGAAGAAAGG + Intergenic
1130633276 15:85591516-85591538 TTGCTTTTGGTGCAGAAATTAGG + Intronic
1130726578 15:86445372-86445394 CTGCTTTGGCTGAAGCAAAAGGG - Intronic
1131557502 15:93412586-93412608 CTGCTTCAGGTGAAGAATGAGGG + Intergenic
1131936828 15:97515511-97515533 CTCCTTCTTTTGAAGAAAAAGGG + Intergenic
1132886846 16:2185939-2185961 TTGCTCTTGGTGAAGAAAAAAGG - Intronic
1134801883 16:17091952-17091974 CTACTTTTGCTGGAGGAAAAGGG + Intergenic
1135988053 16:27198735-27198757 CTGCTTTTCATGAAAAAGAAAGG - Intergenic
1136986660 16:35112651-35112673 CAGCTGGTGGTGGAGAAAAAAGG + Intergenic
1137802076 16:51270733-51270755 CTGCCTTTGGCCAATAAAAATGG + Intergenic
1137868135 16:51922645-51922667 CAGGCTTTGGTGAAGAAAATAGG - Intergenic
1138773100 16:59688074-59688096 TTGCTTTTGGATAAGAAAGAAGG + Intergenic
1139907061 16:70373491-70373513 CTGTTTTTGTAAAAGAAAAATGG - Intergenic
1140070747 16:71647787-71647809 CTTCTTTTGGGGATGAAAATGGG - Exonic
1142255950 16:89014048-89014070 CTGCATTTGGGGAGGAAAAGGGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143817776 17:9532518-9532540 CTGCTTCTGGGGAAGAAAATGGG + Intronic
1144073573 17:11696533-11696555 CTGCTTGTGGTGAAGCAAAAGGG - Intronic
1144092264 17:11868751-11868773 CTGCTTGAGTTGGAGAAAAATGG - Intronic
1145098744 17:20055676-20055698 CTGCCTTTAGTGAAAAACAATGG - Intronic
1146430659 17:32790875-32790897 GTCCTTTTAGTTAAGAAAAATGG - Intronic
1147055227 17:37828959-37828981 CTGCTTCTGGTGACGAAACAGGG + Intergenic
1149341420 17:55690402-55690424 CTGCTTTTGCTTGAGAAAAATGG + Intergenic
1152551170 17:81031073-81031095 CTGCCATTGGTGAAGAACACGGG + Intergenic
1153137933 18:1939474-1939496 CTGCTTTTTCTATAGAAAAAAGG - Intergenic
1153453894 18:5259730-5259752 CTGCCTTTGGAAAAGAACAATGG + Intergenic
1153837300 18:8975632-8975654 CTTCTTTGGATGAAGAAAGAGGG - Intergenic
1154959459 18:21293623-21293645 CTGTTTTGGCTGAATAAAAAGGG - Intronic
1155635936 18:27955477-27955499 CTGAATTTGGAGGAGAAAAAAGG + Intronic
1156198167 18:34799429-34799451 CTTTTTTTGGTGCAGAGAAATGG - Intronic
1156442210 18:37202137-37202159 ATGCTTTTGTTAAAAAAAAATGG - Intronic
1156956070 18:42964952-42964974 CTGTTTTTGCTCAAGCAAAATGG - Intronic
1157270141 18:46268180-46268202 CTGCTTTTGAAGAAGAAACTAGG + Intergenic
1157774379 18:50380547-50380569 CTGCTTTGGGTGAGGAGATATGG + Intronic
1158473393 18:57758695-57758717 CTACTTTTGTAAAAGAAAAAAGG - Intronic
1158601700 18:58861832-58861854 CATCTTTGGGAGAAGAAAAAAGG + Intergenic
1159086470 18:63797938-63797960 CTGCTTTAGCTGAAGAACAGTGG - Intronic
1159401908 18:67949197-67949219 CTTCATTTAGTGAAAAAAAAAGG - Intergenic
1159634770 18:70791003-70791025 CTTTTTTTTGTGAAGACAAATGG - Intergenic
1159746510 18:72242862-72242884 CTCCTCAGGGTGAAGAAAAATGG + Intergenic
1159750177 18:72291280-72291302 CAGCCTTTGGTCTAGAAAAAAGG + Intergenic
1160602123 18:80021807-80021829 CTGCTTTTGGTTACGGAAGAAGG + Intronic
1162533984 19:11252543-11252565 CTTCTTTTGCTGCAGAAAACTGG - Exonic
1162587879 19:11572215-11572237 TTGCTTTTGGTGTAAAAAATGGG + Intronic
1163177744 19:15576291-15576313 CTGAGCTTGGTGGAGAAAAAGGG + Intergenic
1163183861 19:15622820-15622842 CTGAGTTTGGTGGAGAAAATGGG + Intronic
1167950873 19:53026679-53026701 TTGCTTTTTGTGGAGAACAACGG - Intergenic
1168274629 19:55270562-55270584 CTACTGTTGCTTAAGAAAAAAGG + Intronic
1168380538 19:55917591-55917613 TTGCTTTTTGTGAAGCAAAGGGG - Intronic
925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG + Intergenic
926238956 2:11070243-11070265 TTACTTTGGGTAAAGAAAAAAGG - Intergenic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
926960855 2:18357032-18357054 CTTCTTTTGGGGAAGAAGCAGGG + Intronic
927324978 2:21794293-21794315 CTGTTTTTGGTAGGGAAAAAAGG + Intergenic
929205919 2:39292737-39292759 CTGTTTTTGGTAAAAAGAAAAGG - Intronic
929570373 2:43019072-43019094 CTGATTGTGTTGAAGAACAATGG - Intergenic
929911346 2:46091993-46092015 ATGAGTTTGATGAAGAAAAACGG - Intronic
931116381 2:59171166-59171188 CAGCTTTTGGTGTAGGAGAATGG + Intergenic
931188493 2:59976785-59976807 CTGTCACTGGTGAAGAAAAATGG + Intergenic
931298010 2:60948585-60948607 TTTTTTTTGGTGAAGGAAAAGGG + Intronic
931513528 2:63025951-63025973 CTGCTTTAAGAAAAGAAAAATGG + Intronic
932018582 2:68059107-68059129 CTGCTTTTGGTGAGATAAAGGGG + Intronic
933070402 2:77850295-77850317 CTTCTTTTGGTAAATATAAAGGG - Intergenic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
935064686 2:99637152-99637174 CTCCTTTTAGTAAAGAAAACTGG - Intronic
935550810 2:104451479-104451501 CTGCTTTTAATAAAGAAAAGGGG + Intergenic
936461943 2:112720867-112720889 CTGCTTTTGCTCTAGAGAAAAGG + Intergenic
936600084 2:113887423-113887445 TTTCTCTTGGGGAAGAAAAAAGG + Intergenic
936744436 2:115557716-115557738 AGGCTTTTGGTAAAGAAAGATGG + Intronic
937345475 2:121122941-121122963 CTGCTTTTGTTGTAGAAACAGGG + Intergenic
938758933 2:134406292-134406314 CTGGTTGTGGGGAAGAAAACAGG + Intronic
940395186 2:153182008-153182030 CTGCTTATTATTAAGAAAAATGG - Intergenic
941093299 2:161204988-161205010 ATGCTTGTGATGTAGAAAAACGG - Intronic
941576904 2:167244091-167244113 CTGCCTCTGAAGAAGAAAAAGGG + Exonic
943383156 2:187174658-187174680 CTGTTTCTGGTTAGGAAAAAAGG + Intergenic
943470214 2:188286087-188286109 CTGCAATTGTTGTAGAAAAATGG + Intergenic
944252754 2:197593931-197593953 TTGCTTTGGGGGAAGAAGAAAGG + Intronic
944635689 2:201674101-201674123 ATGCCTTTGGTGAATAAATATGG - Intronic
944908766 2:204288639-204288661 CTGCCTTTGGGGATGAAGAAAGG + Intergenic
945102808 2:206277642-206277664 CTGCTTTAGAGGAACAAAAATGG + Intronic
945428619 2:209738363-209738385 GTGCTTTTGAAGCAGAAAAATGG - Intergenic
945923428 2:215779381-215779403 TTACCTTTGGGGAAGAAAAACGG + Intergenic
946469506 2:219945330-219945352 CTGGATATGCTGAAGAAAAATGG + Intergenic
946518114 2:220435510-220435532 TTGCCTTTGGTGATGCAAAATGG - Intergenic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
947204705 2:227649793-227649815 GTGTTTATTGTGAAGAAAAAAGG + Intergenic
948342000 2:237260883-237260905 CTGCTTATGGTGGAGAGCAATGG + Intergenic
1169883434 20:10372111-10372133 CTTGCTTTGGGGAAGAAAAAGGG - Intergenic
1170187899 20:13612275-13612297 CTCGTTTTGGAGAAGGAAAAAGG - Intronic
1172556319 20:35844524-35844546 GTGGTGATGGTGAAGAAAAATGG - Intronic
1173705289 20:45105769-45105791 CTGCTATTGGTAAGGAAGAAGGG + Intergenic
1173919638 20:46733963-46733985 CTGCTTTTGCTGGGGTAAAAAGG + Exonic
1174556936 20:51402470-51402492 CTGCCTTTGGAAAAAAAAAAAGG + Intronic
1174696471 20:52564751-52564773 CTGCTTTGGGTGAAGACAACAGG - Intergenic
1175273442 20:57751109-57751131 TTGCTTCTGGGGAAGAGAAATGG - Intergenic
1176151485 20:63593563-63593585 CTTGTTCTGGTGTAGAAAAATGG - Intronic
1176721410 21:10396788-10396810 TTTCTTTTGGGGAAAAAAAAAGG + Intergenic
1177287201 21:19066869-19066891 CTCCTTTTTTTGAAGCAAAAGGG - Intergenic
1178366533 21:31993111-31993133 CTGCTATGGGGGCAGAAAAAAGG - Intronic
1178378504 21:32089068-32089090 ATGCTGTTGATGCAGAAAAATGG + Intergenic
1178540565 21:33446068-33446090 CTGATTATGGGGAATAAAAATGG - Intronic
1180113891 21:45683241-45683263 CTGTTTTTGGTGGAGTAATAGGG + Intronic
1180115517 21:45701308-45701330 GTGGTTTTGGTGAAGAACCATGG - Intronic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1182749707 22:32631899-32631921 CTGCCTTTGGTGACATAAAAGGG - Intronic
1183422768 22:37721812-37721834 CTGCTTTAGGTGAAGAGTAAAGG - Intronic
1184260412 22:43312248-43312270 CTGCTTTTGGGGAAGAAGAGAGG + Intronic
1184710631 22:46247470-46247492 CTGCTTTTGGCTGAGAACAAGGG - Intronic
950472418 3:13194331-13194353 CTGCTGTAGGTCAAGAAACACGG - Intergenic
950598471 3:14008212-14008234 CTGCTTCTGGGGAAGTAATAGGG - Intronic
950853386 3:16083588-16083610 CTTCTTTTGCTAAAGAAGAAGGG + Intergenic
950958806 3:17082785-17082807 TAACTTTTCGTGAAGAAAAAAGG + Intronic
950988623 3:17406016-17406038 CTGCCATTTATGAAGAAAAAAGG + Intronic
951087180 3:18526791-18526813 CTACTTTTGGAGAAAAAAATAGG + Intergenic
951162689 3:19444797-19444819 ATCATTTTGGTGAACAAAAATGG - Intronic
951205349 3:19920564-19920586 CTGCCTTTGGGGGAAAAAAATGG + Exonic
951545668 3:23822481-23822503 CTTTTTTTGGTGAGGAAAGAGGG - Intronic
951876947 3:27437854-27437876 GTAGTTTTGGTGAGGAAAAAGGG - Intronic
952981588 3:38740452-38740474 CTTCTTATGGAGAAGAAAACAGG + Intronic
953813802 3:46136572-46136594 CTGCTGTTGGTAATGTAAAATGG - Intergenic
956276434 3:67506686-67506708 TTGCTTTGCATGAAGAAAAATGG - Intronic
957477597 3:80746599-80746621 CTGCTTGTGCTGAACAAAAGTGG - Intergenic
957506730 3:81131026-81131048 CTGCATTTTATGAAGAAAAGAGG - Intergenic
957590265 3:82187920-82187942 CTGGTTTTGGGGAAAAAAATTGG - Intergenic
957755618 3:84482601-84482623 CTGATATGGGTGTAGAAAAAAGG + Intergenic
957794349 3:84984196-84984218 CATCTTATGGTGAAGAAATATGG - Intronic
958995894 3:100904618-100904640 TTGCTTTAGATGCAGAAAAAAGG + Intronic
959818972 3:110709686-110709708 CTGCTAGTGGTGCAGAAAAATGG - Intergenic
959984437 3:112557085-112557107 TTGTTTTTGGTGAAGACACATGG - Intronic
961074171 3:123966228-123966250 CTCCTTTTGCTCCAGAAAAAAGG - Intergenic
962074746 3:132069995-132070017 CTCATTTTGGGGAAGAAAGAGGG - Intronic
962360341 3:134736858-134736880 CTGATTTTGAGGAAGAATAAGGG + Intronic
963502708 3:146147949-146147971 CTTGTTTTGGAGGAGAAAAAAGG - Intronic
964137003 3:153355276-153355298 CAGCTTGTGGAGAAGAAAAAAGG + Intergenic
964148548 3:153496049-153496071 ATAATTGTGGTGAAGAAAAATGG - Intronic
964905523 3:161715027-161715049 CTTCCTTTGGTGAGAAAAAAAGG + Intergenic
965922813 3:173939850-173939872 CTTCTTTTGGATAACAAAAATGG - Intronic
966279112 3:178208610-178208632 CTGCTATGGGTGAAGGAGAAGGG - Intergenic
966422044 3:179743569-179743591 ATCCTTTTGGTGTAGAAACAAGG + Intronic
966564940 3:181367999-181368021 TTGCTATTAATGAAGAAAAAAGG - Intergenic
967146930 3:186614318-186614340 TTGCTTTTGATATAGAAAAATGG - Intronic
967212374 3:187180244-187180266 CTGCTAATGGTGAAGGAGAAGGG + Intronic
967491679 3:190099026-190099048 GTGCTTTTTTTTAAGAAAAAGGG + Intronic
969953176 4:10861309-10861331 CTGGTTTTAGTGAAGCAAACAGG - Intergenic
970695610 4:18673413-18673435 ATACTTTTGGTGAAGAACAATGG + Intergenic
970696448 4:18683839-18683861 CTGCTTTTGGTAATTAAAATTGG - Intergenic
970931458 4:21517078-21517100 TAGCTTTTTGTGAAGAACAATGG + Intronic
971149531 4:24016934-24016956 CTCCTTTTAGTGGAGAAGAAAGG + Intergenic
971400135 4:26268545-26268567 GTGCTTTTATTGAAGAGAAAAGG - Intronic
971536463 4:27758114-27758136 CTGCATTTGATTAAGAAAAAAGG - Intergenic
972925407 4:43999633-43999655 CTGCTTGTGGTACAGGAAAAAGG + Intergenic
973017178 4:45154960-45154982 CTGCATGGGGTGAAGATAAAGGG + Intergenic
973601788 4:52549480-52549502 CTGCTTTGGGTAAAATAAAAAGG + Intergenic
974005064 4:56547696-56547718 ATGTTTTTGGTAAAGAAAAGTGG - Intronic
974191872 4:58515436-58515458 CTGCCTATGCTGAAGACAAAAGG + Intergenic
974310518 4:60202792-60202814 CTGTCTTTTGTGAATAAAAATGG + Intergenic
975259925 4:72286554-72286576 GTGCTTTTTGTCAAGAAAATTGG - Intronic
976033044 4:80781184-80781206 TTACTTTTTCTGAAGAAAAATGG - Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978378594 4:108102406-108102428 GTGCCTTTGCTGAAGAGAAAGGG - Intronic
978889618 4:113808613-113808635 CTGCTTTTAGGGAAAAAAAAGGG - Intergenic
979402026 4:120260592-120260614 ATGCTTGTGGTAAAAAAAAATGG - Intergenic
980466848 4:133197789-133197811 CTTCTTTTGATCATGAAAAAAGG + Intronic
981274793 4:142886309-142886331 CAGGTTTTGGTGAATAAAATGGG - Intergenic
982423722 4:155230313-155230335 CTGATTTTTTTAAAGAAAAAAGG - Intergenic
982672117 4:158333465-158333487 CTGCTTCTGGTCAAGCAAAGTGG + Intronic
985858621 5:2450948-2450970 GTGCTTCTGGTGAAGGAGAAAGG - Intergenic
986788247 5:11135203-11135225 CTGCTTTTCGTAAATAATAATGG + Intronic
986861407 5:11930938-11930960 TTGCTTGTAGTGAAAAAAAAAGG + Intergenic
986988746 5:13527460-13527482 ATGCTATTGGAGAAGAGAAATGG + Intergenic
986993092 5:13576595-13576617 CTGGCTTTGGTGAGGACAAAGGG + Intergenic
988215715 5:28269613-28269635 CTTCTTTTGGAGAGGAGAAATGG + Intergenic
988424918 5:31052969-31052991 CTCCTCATGGAGAAGAAAAATGG + Intergenic
989652280 5:43705941-43705963 CTACTTTGAGAGAAGAAAAAGGG - Exonic
989761470 5:45021600-45021622 CTACTTTTTGTGAAGCAAATAGG + Intergenic
990082793 5:51937481-51937503 CAACTTGTGGTGAAAAAAAAAGG + Intergenic
990315018 5:54575669-54575691 CTGCTTTAGGTTTAAAAAAAGGG - Intergenic
990691252 5:58366922-58366944 TTAATTTTGGTGGAGAAAAAAGG - Intergenic
990948945 5:61277464-61277486 CTGCTTTTAGTTCAGAGAAATGG - Intergenic
991037443 5:62142108-62142130 CTGCTTTAGGGAAAGAAACAAGG + Intergenic
992263653 5:74995363-74995385 CTGCTTTTAGAAAACAAAAAGGG - Intergenic
992606953 5:78467259-78467281 CTGCTGTGGGTGAAGTATAAAGG + Intronic
993307725 5:86291711-86291733 CTGCTTTTTTTGAAATAAAAGGG + Intergenic
994744348 5:103660374-103660396 AGGATTCTGGTGAAGAAAAATGG + Intergenic
994930476 5:106176567-106176589 CTGCCTTTTTTGAAAAAAAATGG - Intergenic
995403417 5:111766771-111766793 CTGGTTCTGGTGAAGGAGAAGGG + Intronic
995543286 5:113205053-113205075 CTACTTTTGGTGAAGGAAGCAGG + Intronic
995583246 5:113622159-113622181 TTGCTTTTGATAAGGAAAAATGG + Intergenic
996703399 5:126472357-126472379 TTAGTTTTGGGGAAGAAAAAGGG + Intronic
997005178 5:129808206-129808228 TTGCTTATGCTGAAGAAATATGG + Intergenic
997855307 5:137367862-137367884 TTGCTTTGGATGCAGAAAAAGGG + Intronic
999331094 5:150673855-150673877 CTGCATTTAGTGAGGAAAAGGGG + Intronic
999552247 5:152702000-152702022 CTGATCTTGGTGAAGGAAAGGGG + Intergenic
1000676135 5:164125022-164125044 CTGCTTTTTGTGATGTAAATGGG + Intergenic
1000726989 5:164783789-164783811 CTACTTTAGATGAAAAAAAATGG + Intergenic
1000732399 5:164852406-164852428 GTGATTTTCGAGAAGAAAAATGG - Intergenic
1000733131 5:164861336-164861358 CTGCTCTTTATGAAGAAATAAGG - Intergenic
1002845485 6:940866-940888 CTGCTTCTCGTGAGGAAAACAGG + Intergenic
1002880519 6:1246904-1246926 TTGCTTTTGCTAAAGAGAAAAGG + Intergenic
1003301413 6:4886331-4886353 CTGCTTGTGGTAATGTAAAATGG - Intronic
1003374693 6:5565023-5565045 GTCCTGTTGATGAAGAAAAATGG + Intronic
1004106060 6:12668376-12668398 CTGCTAAGGGTGAAGAAGAAGGG - Intergenic
1004496877 6:16172740-16172762 CTTATTTTGGTGAAGGAAAGTGG + Intergenic
1005245071 6:23874307-23874329 GTGATTTTGGGGAAGAAACAAGG - Intergenic
1006177998 6:32134876-32134898 CTCCTTTAAGTGAAGAAAATTGG + Intergenic
1006350712 6:33519129-33519151 CTGCCTGTGGTGAAGACACAAGG - Intergenic
1006758570 6:36439284-36439306 CTGCATTTGGAAAAGAAAATAGG - Intronic
1008445158 6:51580677-51580699 AGGCTAGTGGTGAAGAAAAAGGG + Intergenic
1009464998 6:63957838-63957860 CTGTTTTTAGTAAAGAAACAAGG + Intronic
1009578301 6:65495529-65495551 CTACTTTGGGTATAGAAAAAAGG - Exonic
1010377620 6:75190482-75190504 CTACTTTTAGTGAACAAAGAGGG + Intronic
1010515754 6:76771121-76771143 CTGCTTTTGCGGAAGAAACTTGG - Intergenic
1011230509 6:85156137-85156159 CTGTTTTTGCTGAAAACAAAGGG + Intergenic
1011305583 6:85922741-85922763 CTCATTTTGGTGAAGAAACTGGG - Intergenic
1011410410 6:87060359-87060381 TTGCTTTCAGTGAAGAAAGAAGG + Intergenic
1013958762 6:115872330-115872352 ATGCTTTGAGTGAGGAAAAATGG - Intergenic
1014614881 6:123587041-123587063 CTGCTCAGGGTGAAGGAAAAGGG + Intronic
1014919872 6:127201561-127201583 CTCCTTTTGGGGAAGAATATAGG - Intergenic
1015006773 6:128291882-128291904 CTACTCTTGTTGTAGAAAAAGGG + Intronic
1015565577 6:134567134-134567156 CTGCTTTGGATGAAGAGAGAGGG - Intergenic
1016336284 6:143008427-143008449 CTGATTTTGGGAAATAAAAACGG + Intergenic
1016492579 6:144623559-144623581 CAGAATTTAGTGAAGAAAAATGG + Intronic
1016776076 6:147906121-147906143 ACGCTTTTAATGAAGAAAAAAGG + Intergenic
1017240340 6:152161482-152161504 ATGCTTTTTTTAAAGAAAAATGG + Intronic
1018061635 6:160094155-160094177 CTGCTTTTGGTCTATAAACAGGG + Intronic
1018283702 6:162215255-162215277 CTGGTGTTGATGAATAAAAACGG + Intronic
1020488813 7:8752743-8752765 TTGTTATTGGTTAAGAAAAAAGG + Exonic
1021386978 7:20043605-20043627 CTGCTCTTGTTGCAGCAAAATGG - Intergenic
1021524861 7:21575690-21575712 ATGCCTTTGGGGAGGAAAAATGG - Intronic
1021824619 7:24536940-24536962 CTGCTTTTAGTGAATGACAATGG + Intergenic
1022752927 7:33251213-33251235 CTGCTTTTGGAAAAGCCAAATGG + Intronic
1022887374 7:34660548-34660570 CTGCTTTTGATGAAGGCAATGGG - Intronic
1024094474 7:45973047-45973069 CTGCATTTGGGGAAGACAAGTGG + Intergenic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1027445394 7:78267655-78267677 CTGATTTATGTGAAGAGAAAGGG + Intronic
1027687896 7:81300602-81300624 CTGCTTGTGCTGAAGCTAAAAGG + Intergenic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1034122166 7:148637876-148637898 CTATATTTGGTAAAGAAAAAAGG - Intergenic
1034186121 7:149178712-149178734 CTGCTGGTGGAGAAGAGAAAGGG - Exonic
1034345965 7:150385197-150385219 CTGCTTGTGGTGCAGAGAAAAGG - Intronic
1035214212 7:157352686-157352708 CTGCTTGTGATGAAGTAGAAAGG - Intronic
1035361940 7:158318947-158318969 CAGCTTTTCATAAAGAAAAATGG + Intronic
1035551154 8:527121-527143 CTGCTTTTGGTGTATAGAAATGG - Intronic
1035870157 8:3129187-3129209 CTGCTATTGCAGGAGAAAAAGGG + Intronic
1037691827 8:21187333-21187355 GTGCTTTGGGGGAAGAAAACTGG - Intergenic
1038007339 8:23443623-23443645 CTACATGTGGTGAAGACAAACGG + Intronic
1038178130 8:25199897-25199919 CTGCTTATGGTAAAGAACAAGGG - Intronic
1038180406 8:25222085-25222107 CTGTTTTCTGTGAAGGAAAAAGG + Intronic
1040792648 8:51250772-51250794 ATGCTTTTGGCCAAGAAAATTGG + Intergenic
1041962488 8:63634609-63634631 CTACCTCTGGTGAAGAAAAGTGG - Intergenic
1042024804 8:64411703-64411725 CTGAGTTTGGGGAAGAAACAGGG - Intergenic
1042388031 8:68200807-68200829 TTGCTTTTGGTGCATATAAAAGG + Intronic
1043016139 8:74942425-74942447 TTGCTGGTGGTGAAGTAAAATGG + Intergenic
1043563956 8:81527287-81527309 CTAATTCTGCTGAAGAAAAAAGG + Intronic
1043816121 8:84803659-84803681 CTGCTTTGGGTGAATCATAATGG - Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1045043434 8:98249959-98249981 CTGCTTCTGGAAAGGAAAAATGG + Intronic
1045129741 8:99137601-99137623 TTGTTTTTGATGAAGAAAGAAGG + Intronic
1045707064 8:104936646-104936668 CTGCCATTGGGGAAGAAGAAAGG + Intronic
1046042492 8:108922987-108923009 CTGCTTTTGGGGATCAAAGAAGG + Intergenic
1046102671 8:109632458-109632480 ATTCTTATTGTGAAGAAAAATGG - Intronic
1048513509 8:135083087-135083109 GTAATTTTGGTGAAGGAAAAAGG - Intergenic
1049233483 8:141496224-141496246 CTGCTTTTGGTGGAGGGACATGG + Intergenic
1050259954 9:3830595-3830617 CTGGTTTTGATGGAAAAAAAGGG + Intronic
1050425546 9:5509171-5509193 TTGCTTTTGTAGAAGAAACAAGG + Intergenic
1050568501 9:6912846-6912868 CTACTTTTGATAAAGAAATAAGG + Intronic
1050806375 9:9683564-9683586 TTGCTTTTGGAAAGGAAAAAGGG + Intronic
1052183956 9:25566537-25566559 CTGCTTTAGGAAAACAAAAAAGG - Intergenic
1052585543 9:30423753-30423775 CTGCTTTTAGAGAAAAATAAAGG - Intergenic
1055126979 9:72730304-72730326 CTGGTTTTGGGGAAGAACAAGGG + Intronic
1055225668 9:73991383-73991405 CTGCTTTTGATGTATAGAAATGG - Intergenic
1055246514 9:74251202-74251224 CTACTTTTGGAAAAGAAAATAGG + Intergenic
1057455781 9:95208781-95208803 CTGCTGATGGGGATGAAAAATGG + Intronic
1057862739 9:98654740-98654762 CTCCTTTGGGTGAAGACCAAGGG - Intronic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059610582 9:115888454-115888476 CTGATTTTTGAAAAGAAAAAAGG - Intergenic
1060786780 9:126457317-126457339 CTGCTTTTGCAGGAGAAAAGTGG + Intronic
1187027755 X:15453966-15453988 CTGCTTTGGTTGAAGCAGAAGGG + Intronic
1187834115 X:23413465-23413487 TTGCTTTAGGTGATGAAAAGTGG + Intergenic
1189717156 X:43878668-43878690 TCACCTTTGGTGAAGAAAAATGG - Intronic
1189734888 X:44059687-44059709 CTTCTAATGGAGAAGAAAAAAGG - Intergenic
1189824606 X:44904865-44904887 AAGCGTTTAGTGAAGAAAAATGG - Intronic
1190553052 X:51604806-51604828 CTTCTCTTAGTGAAGAAAATTGG + Intergenic
1191025155 X:55906493-55906515 CTTCTAGTGGTGAAGGAAAATGG + Intergenic
1191724590 X:64266384-64266406 CTTCTTTTGGGAAAAAAAAATGG - Intergenic
1191777160 X:64827385-64827407 CTGCTTCTGGAGATGAAAATTGG - Intergenic
1192047609 X:67692743-67692765 CTTCTTTTGTGGATGAAAAATGG + Intronic
1192264055 X:69526623-69526645 ATACTTGTGGTGAAGAAACAAGG + Intronic
1193600451 X:83503854-83503876 CAGCTTTTGAAAAAGAAAAAAGG + Intergenic
1194432125 X:93821756-93821778 CTGGTTTTGGAGAACAATAATGG - Intergenic
1194615818 X:96102614-96102636 CTGCTGTTGGAGATGTAAAATGG + Intergenic
1194827731 X:98583262-98583284 CTAGTTTAGGAGAAGAAAAAGGG + Intergenic
1195263300 X:103154999-103155021 CTGCTGGTGGTTATGAAAAATGG - Intergenic
1195361010 X:104084130-104084152 CTGCTTGTGGGGAACAGAAAAGG - Intergenic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1195770368 X:108344802-108344824 CTGCTCTTGATGGAGGAAAATGG - Intronic
1195775802 X:108404855-108404877 CTACTTTTGGTGAAAAGAAAGGG - Intronic
1195842246 X:109186970-109186992 CTGTTTTTGGTAAGGATAAAAGG + Intergenic
1197039639 X:121921068-121921090 CTGCTTTTGGTAATTAAAGATGG + Intergenic
1197414100 X:126153162-126153184 CTTCTTTTAGAGAAAAAAAATGG - Intergenic
1198154925 X:133949795-133949817 GTGGTTCTTGTGAAGAAAAATGG - Intronic
1198521545 X:137458409-137458431 CTGCTGATGGGGAAGTAAAATGG - Intergenic
1198701617 X:139402831-139402853 CTGCTATTGTAGAAAAAAAATGG + Intergenic
1198711985 X:139514375-139514397 CTGCTCTTGGCAAAGTAAAACGG - Intergenic
1198971878 X:142291103-142291125 CTGCATTTGCTTAGGAAAAAAGG - Intergenic
1199050580 X:143232369-143232391 CTCCTTCTGCTTAAGAAAAACGG + Intergenic
1199168764 X:144710115-144710137 CTGCTCATGGTGTAGTAAAAAGG - Intergenic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic