ID: 977951938

View in Genome Browser
Species Human (GRCh38)
Location 4:102981064-102981086
Sequence CTGTTAGAATGTCATATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 871
Summary {0: 1, 1: 0, 2: 12, 3: 134, 4: 724}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977951931_977951938 30 Left 977951931 4:102981011-102981033 CCTCTCAATTCCTGACAACCACT 0: 1
1: 2
2: 27
3: 128
4: 613
Right 977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG 0: 1
1: 0
2: 12
3: 134
4: 724
977951933_977951938 12 Left 977951933 4:102981029-102981051 CCACTGATCTTTTTACTGTGTCC 0: 5
1: 183
2: 529
3: 724
4: 1018
Right 977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG 0: 1
1: 0
2: 12
3: 134
4: 724
977951932_977951938 20 Left 977951932 4:102981021-102981043 CCTGACAACCACTGATCTTTTTA 0: 34
1: 252
2: 634
3: 967
4: 1870
Right 977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG 0: 1
1: 0
2: 12
3: 134
4: 724
977951934_977951938 -9 Left 977951934 4:102981050-102981072 CCATAGTTTTGCCCCTGTTAGAA 0: 1
1: 0
2: 0
3: 20
4: 294
Right 977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG 0: 1
1: 0
2: 12
3: 134
4: 724

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977951938 Original CRISPR CTGTTAGAATGTCATATAGT TGG Intronic
900811979 1:4811142-4811164 CTTTTGGAATGTCACATAGTTGG - Intergenic
901406662 1:9052325-9052347 TTCCCAGAATGTCATATAGTTGG - Intronic
902136962 1:14315620-14315642 TTGTTAGAATTTCATATAAATGG + Intergenic
902424895 1:16312441-16312463 TTTCTAGAAGGTCATATAGTTGG - Intronic
902854803 1:19193965-19193987 TTTCTAGAATGTCATGTAGTTGG - Intronic
903819509 1:26091211-26091233 TTTCCAGAATGTCATATAGTTGG - Intergenic
905498284 1:38414464-38414486 TTGCCAGAATGTCATATAATTGG - Intergenic
906452779 1:45966088-45966110 TTTCCAGAATGTCATATAGTTGG + Intronic
906701659 1:47864021-47864043 TTTCCAGAATGTCATATAGTTGG - Intronic
906806401 1:48782987-48783009 TTTCCAGAATGTCATATAGTTGG + Intronic
907025849 1:51117577-51117599 TTTCCAGAATGTCATATAGTTGG + Intronic
907699114 1:56766041-56766063 CTTGTAGAAGGACATATAGTTGG + Intronic
908328588 1:63048348-63048370 TTTCTAGAATGTCATGTAGTTGG - Intergenic
908585921 1:65568142-65568164 ATGTCATAATGTCATATAGTTGG + Intronic
909098361 1:71318555-71318577 TTTCTAGAATATCATATAGTTGG - Intergenic
909111621 1:71485655-71485677 TTTCTAGAATGACATATAGTAGG + Intronic
909509193 1:76432050-76432072 TTTCTAGAATGTCATATACTTGG + Intronic
909728222 1:78861867-78861889 TTTCCAGAATGTCATATAGTTGG + Intergenic
910136158 1:83972328-83972350 TTTCTAGAATGTCATATGGTTGG + Intronic
910372578 1:86532335-86532357 ATGCCAGAATGTCAAATAGTTGG + Intergenic
910767985 1:90801580-90801602 TTTTCAGAATGTCATATAGCTGG + Intergenic
911342981 1:96661875-96661897 TTTCCAGAATGTCATATAGTTGG + Intergenic
911351128 1:96756707-96756729 TTTCCAGAATGTCATATAGTTGG - Intronic
911390598 1:97236487-97236509 TTTCCAGAATGTCATATAGTTGG - Intronic
911579180 1:99615714-99615736 TTCTCAGAAAGTCATATAGTTGG - Intergenic
911723321 1:101215001-101215023 TTGCCAGAATGTCATATAGTAGG - Intergenic
911813716 1:102315543-102315565 TTTTCAGAATGTCATTTAGTTGG - Intergenic
911945848 1:104108001-104108023 TTTCTAGAATATCATATAGTTGG + Intergenic
911946992 1:104123760-104123782 TTTCCAGAATGTCATATAGTTGG + Intergenic
912367557 1:109147367-109147389 TTTCTAGAATGTCATATAGTTGG - Intronic
912626640 1:111210451-111210473 TTTCCAGAATGTCATATAGTTGG + Intronic
912660690 1:111526911-111526933 TTTTCAGAATGTCATATATTTGG + Intronic
912854514 1:113155132-113155154 TTTACAGAATGTCATATAGTTGG + Intergenic
912997422 1:114544890-114544912 TTTCCAGAATGTCATATAGTTGG + Intergenic
913503521 1:119494439-119494461 TTTCCAGAATGTCATATAGTTGG - Intergenic
913507437 1:119530588-119530610 TTTCTAGAATGTCATATAGTTGG - Intergenic
914597992 1:149173397-149173419 CAGTTTGAATGTCATAAAGATGG - Intergenic
916149254 1:161770142-161770164 TTTGCAGAATGTCATATAGTTGG + Intronic
916190997 1:162178062-162178084 TTTCCAGAATGTCATATAGTTGG + Intronic
916657992 1:166894525-166894547 TTTCCAGAATGTCATATAGTTGG + Intergenic
917590672 1:176473253-176473275 TTTCTAGAATGTCATATAATTGG + Intronic
918273886 1:182931994-182932016 TTTCCAGAATGTCATATAGTTGG + Intronic
918288465 1:183081957-183081979 TTCCCAGAATGTCATATAGTTGG + Intronic
918534797 1:185561977-185561999 TTTCTGGAATGTCATATAGTTGG - Intergenic
918584265 1:186167705-186167727 TTTCCAGAATGTCATATAGTTGG + Intronic
918667753 1:187172805-187172827 TTGCTAGAATATCATATAGTTGG + Intergenic
918767453 1:188505306-188505328 TTTTAAGAATGTCATATAGTTGG + Intergenic
918776895 1:188643660-188643682 GCTTTAGAATGTCATAGAGTTGG + Intergenic
919272726 1:195370806-195370828 TTTCCAGAATGTCATATAGTTGG - Intergenic
919556514 1:199061740-199061762 TTTTCAGAATGTCATATAGCTGG - Intergenic
920028916 1:203024076-203024098 CTGTTAGAAGGGCATTTATTAGG + Exonic
920889347 1:209968606-209968628 TTTCCAGAATGTCATATAGTTGG + Intronic
921243542 1:213212297-213212319 TTTCCAGAATGTCATATAGTTGG + Intronic
921273442 1:213492630-213492652 GTGTTTGAATGTCATATAATAGG + Intergenic
921422554 1:214965080-214965102 TTTCCAGAATGTCATATAGTTGG + Intergenic
921435188 1:215111054-215111076 TTTTCAGAATGTCATATAGTTGG + Intronic
921536787 1:216360328-216360350 TTTCTAGAATATCATATAGTTGG - Intronic
921772944 1:219064557-219064579 CTGTCAGAATTTCATATAAATGG - Intergenic
921802648 1:219418869-219418891 TTGCTAGAATGTCATATAGTTGG + Intergenic
922254531 1:223882126-223882148 TTTCCAGAATGTCATATAGTTGG - Intergenic
922272603 1:224047952-224047974 CTTCTAGAGTGTTATATAGTTGG - Intergenic
922997798 1:229980385-229980407 TTTCCAGAATGTCATATAGTTGG - Intergenic
923278990 1:232423905-232423927 TTTCTAGAATGTCGTATAGTTGG - Intronic
924364504 1:243276867-243276889 CTTGCAGAATGTCATATACTTGG + Intronic
924500710 1:244635873-244635895 TTTTTAGGATGTCATATAGGGGG - Intronic
924532055 1:244901800-244901822 TTTCTAGAATGTCATATAATTGG + Intergenic
1063983129 10:11472232-11472254 CTGTTAGAATATTATTTTGTTGG - Intronic
1067053026 10:43035917-43035939 CTTCTAGAATGTCAGATAATTGG - Intergenic
1067076347 10:43187111-43187133 TTTCCAGAATGTCATATAGTTGG + Intergenic
1067144030 10:43680654-43680676 CTTTGAGAATGTCATATAAATGG + Intergenic
1067320435 10:45215312-45215334 TTTCCAGAATGTCATATAGTTGG - Intergenic
1067857598 10:49808892-49808914 CTTCCACAATGTCATATAGTTGG - Intergenic
1068087834 10:52396858-52396880 ATGTTTGAATTTCATATATTTGG - Intergenic
1068485251 10:57649942-57649964 CTGTTTCAGTGTCAAATAGTAGG + Intergenic
1068689676 10:59903080-59903102 TTTCCAGAATGTCATATAGTTGG - Intronic
1068696645 10:59974894-59974916 TTCTCAGAATGTCATACAGTTGG + Intergenic
1068807841 10:61219561-61219583 TTTTCAGAATGTCACATAGTTGG + Intergenic
1069098909 10:64293642-64293664 TTACTGGAATGTCATATAGTTGG + Intergenic
1069240082 10:66128573-66128595 CTTCCAGAATGTCATATAGTTGG - Intronic
1069523368 10:69144498-69144520 TTTCTAGAATGTCATGTAGTTGG + Intronic
1069973472 10:72193397-72193419 TTTTGAGAATGTCATATAGATGG - Intronic
1070146736 10:73779581-73779603 CTGTTAAAATTTGATATAGTAGG + Intronic
1071146533 10:82580616-82580638 TTTCTAAAATGTCATATAGTTGG + Intronic
1071483450 10:86081788-86081810 TTTCTAGAATGTCATATGGTTGG - Intronic
1071704842 10:87986720-87986742 TTTTCAAAATGTCATATAGTTGG - Intergenic
1071874618 10:89831149-89831171 CTGCTAAAATGGCATATATTTGG - Intergenic
1072039804 10:91596061-91596083 TTCCCAGAATGTCATATAGTTGG + Intergenic
1072076290 10:91977308-91977330 TTTCCAGAATGTCATATAGTTGG + Intronic
1072292804 10:93980207-93980229 TTTCCAGAATGTCATATAGTTGG + Intergenic
1072322159 10:94261215-94261237 TTTCCAGAATGTCATATAGTTGG + Intronic
1072571431 10:96661226-96661248 TTTCCAGAATGTCATATAGTTGG - Intronic
1073638538 10:105224305-105224327 TTTCCAGAATGTCATATAGTTGG + Intronic
1073861728 10:107751108-107751130 TTTCTAGAATGTCATGTAGTTGG + Intergenic
1074311768 10:112328568-112328590 ATGGTAGAATGTCATAAGGTGGG - Intergenic
1074799735 10:116987575-116987597 TTTCTAGAATGTCATATAATTGG - Intronic
1074821278 10:117180865-117180887 TTTCTAGAATGTCATATGGTTGG + Intergenic
1075175808 10:120159750-120159772 CTTCCAGAATGTCATATAGTTGG + Intergenic
1075770680 10:124932033-124932055 TTTCTAGAATGTCATATAGTTGG + Intergenic
1076341459 10:129749354-129749376 CTTCCAGAATGTCATCTAGTTGG + Intronic
1076657513 10:132034719-132034741 GTGTGAGAATGTCATATGGAGGG + Intergenic
1078890893 11:15557925-15557947 TTTTCAGAATGTCCTATAGTTGG - Intergenic
1079868968 11:25771701-25771723 TTTCCAGAATGTCATATAGTTGG - Intergenic
1080453588 11:32398845-32398867 TTTTCAGAATGTCATATAGTTGG - Intronic
1080484532 11:32691385-32691407 TTCCCAGAATGTCATATAGTTGG + Intronic
1080650199 11:34216387-34216409 TTTTAAGAATGTCATATAGTTGG + Intronic
1080769696 11:35329171-35329193 TTTCCAGAATGTCATATAGTTGG - Intronic
1080938581 11:36888075-36888097 TTCCCAGAATGTCATATAGTTGG - Intergenic
1081132762 11:39401181-39401203 TTCCTGGAATGTCATATAGTTGG - Intergenic
1081293688 11:41359111-41359133 TTTTCAGAATGTCATGTAGTTGG - Intronic
1081450560 11:43167415-43167437 CTGTTAGACTGGGATAGAGTTGG - Intergenic
1081568338 11:44274314-44274336 CTGTTGGAATGTGTTATATTGGG + Intronic
1081628856 11:44673711-44673733 GTTCCAGAATGTCATATAGTTGG - Intergenic
1081704747 11:45175356-45175378 TTTCCAGAATGTCATATAGTTGG + Intronic
1081727517 11:45341440-45341462 CTTCCAGAATGTCATGTAGTTGG - Intergenic
1082759752 11:57115921-57115943 CTGCTAGAAAGTAATAAAGTCGG + Intergenic
1083052006 11:59785764-59785786 CTTGTAAAATGTCATACAGTAGG - Intronic
1083489627 11:63006507-63006529 CAGTTAGAATGCCATGTAATAGG - Intronic
1083564437 11:63701251-63701273 TTTCCAGAATGTCATATAGTTGG + Intronic
1083916702 11:65750004-65750026 TTTTCAGAATGTCATGTAGTTGG + Intergenic
1084655831 11:70517633-70517655 TTTCTAGAATGTCATGTAGTTGG - Intronic
1086066712 11:82753404-82753426 TTTCCAGAATGTCATATAGTTGG - Intergenic
1086069357 11:82782679-82782701 TTGCCAGAATGTCAAATAGTTGG + Intergenic
1086386489 11:86314289-86314311 CTGTTAGTGTTTTATATAGTTGG + Intronic
1086767857 11:90721062-90721084 TTGCTAGAATGTCATATAGTTGG - Intergenic
1087173654 11:95076120-95076142 TTTCTACAATGTCATATAGTTGG + Intergenic
1088028269 11:105213954-105213976 CTTGCAGAATGTCATATAGTTGG - Intergenic
1088397599 11:109385667-109385689 TTTCTGGAATGTCATATAGTTGG + Intergenic
1088925831 11:114301539-114301561 TTTCCAGAATGTCATATAGTTGG - Intronic
1088931623 11:114357026-114357048 CTTCCAGAATGTCATATAGTTGG + Intergenic
1091446694 12:547853-547875 CTGTTAGCAAGTGATAGAGTGGG + Intronic
1091743399 12:2975900-2975922 TTTCTAGAATGTCATATGGTTGG + Intronic
1091939167 12:4460738-4460760 TTTCCAGAATGTCATATAGTTGG - Intergenic
1092038879 12:5365927-5365949 TTTCCAGAATGTCATATAGTAGG - Intergenic
1092646333 12:10577623-10577645 TTTACAGAATGTCATATAGTTGG - Intergenic
1093109588 12:15133310-15133332 TTTCCAGAATGTCATATAGTTGG + Intronic
1093540985 12:20284586-20284608 CTTTCAGAAAGTCATGTAGTTGG + Intergenic
1093738165 12:22648437-22648459 TTTTCAGAATGTCATATATTTGG + Intronic
1094006840 12:25762583-25762605 TTTCTACAATGTCATATAGTTGG + Intergenic
1094090879 12:26647962-26647984 CTGTCACAATGGCTTATAGTTGG - Intronic
1095092963 12:38124027-38124049 CTGTTAGACTGGGATAGAGTTGG + Intergenic
1095277111 12:40299509-40299531 CTTCCAGAATGTCTTATAGTTGG - Intronic
1095509503 12:42934953-42934975 TTTCTAGAATGTCATATAGTTGG + Intergenic
1095522753 12:43086372-43086394 TTTCCAGAATGTCATATAGTTGG - Intergenic
1096039943 12:48506447-48506469 TTTCTAGAGTGTCATATAGTTGG - Intergenic
1096076176 12:48806549-48806571 TTTTCAGAATGTCCTATAGTTGG - Intergenic
1096728984 12:53590808-53590830 TTTCTAGAATGTCATGTAGTAGG - Intronic
1097291760 12:57922573-57922595 TTACCAGAATGTCATATAGTTGG - Intergenic
1098663264 12:73126852-73126874 ATGTCAGAATTTCATGTAGTTGG + Intergenic
1098807507 12:75038032-75038054 TTTCCAGAATGTCATATAGTTGG - Intergenic
1098833193 12:75388561-75388583 TTTCCAGAATGTCATATAGTTGG - Intronic
1098995968 12:77120157-77120179 CTGCTGGAATGGGATATAGTGGG - Intergenic
1099762112 12:86937306-86937328 TTTCCAGAATGTCATATAGTTGG - Intergenic
1100143257 12:91644528-91644550 TTCCCAGAATGTCATATAGTTGG + Intergenic
1100347823 12:93749299-93749321 CTGCCAGAAAGTCATATTGTTGG + Intronic
1101133780 12:101718047-101718069 TTTAAAGAATGTCATATAGTTGG - Intronic
1101430997 12:104627063-104627085 TTTCCAGAATGTCATATAGTTGG + Intronic
1101432734 12:104640498-104640520 TTTACAGAATGTCATATAGTTGG - Intronic
1102325583 12:111980340-111980362 TTTTTAGAATGTCATATAATGGG - Intronic
1102479999 12:113216299-113216321 TTGCCAGAATGTCATATAGTTGG - Intronic
1102575652 12:113854609-113854631 CTGATAGAATGTCCTAGAGTGGG + Intronic
1102720461 12:115011630-115011652 TTTTGAGAATGTCATGTAGTTGG + Intergenic
1102811719 12:115829963-115829985 CTTCCAGAATGTCACATAGTGGG + Intergenic
1103295648 12:119884367-119884389 TTTCCAGAATGTCATATAGTTGG + Intergenic
1104698948 12:130886623-130886645 TTTCTGGAATGTCATATAGTTGG - Intergenic
1104737399 12:131144649-131144671 ATCCCAGAATGTCATATAGTTGG + Intergenic
1105311029 13:19211322-19211344 TTTCCAGAATGTCATATAGTTGG - Intergenic
1105319638 13:19305954-19305976 TTTCCAGAATGTCATATAGTTGG - Intergenic
1105361254 13:19718895-19718917 TTTCCAGAATGTCATATAGTTGG - Intronic
1105386178 13:19931538-19931560 TTTCCAGAATGTCATATAGTTGG + Intergenic
1105770383 13:23605731-23605753 TTTCTAGAATGTCGTATAGTTGG - Intronic
1105820768 13:24078969-24078991 CAGTTGGAATTTCATATATTGGG - Intronic
1106489216 13:30201884-30201906 TTTCCAGAATGTCATATAGTTGG - Intergenic
1106771442 13:32964456-32964478 TTCCCAGAATGTCATATAGTTGG + Intergenic
1106790307 13:33148981-33149003 CTTTTAGAATGCTATATAGTTGG - Intronic
1106830785 13:33580318-33580340 TTTTCAGAATGTTATATAGTTGG - Intergenic
1106840816 13:33683341-33683363 TTTCTAGAATGTCATATAGATGG - Intergenic
1107663955 13:42669969-42669991 TTTCTAGAATGTCATATAGTTGG - Intergenic
1107785195 13:43948684-43948706 TTTCCAGAATGTCATATAGTTGG - Intergenic
1107961182 13:45560680-45560702 TTTCCAGAATGTCATATAGTAGG + Intronic
1107978831 13:45715021-45715043 TTTTCAGAATGTCATATAGTTGG + Intergenic
1108061664 13:46539136-46539158 TTTCTAGAATGTCATGTAGTTGG + Intergenic
1108217208 13:48196976-48196998 TTTCCAGAATGTCATATAGTTGG + Intergenic
1108220456 13:48228497-48228519 TTTCTAAAATGTCATATAGTTGG + Intergenic
1108316094 13:49239062-49239084 TTTCTAGAATGTCATATAGTTGG - Intergenic
1108392970 13:49966016-49966038 TTTCCAGAATGTCATATAGTTGG - Intergenic
1108457132 13:50627767-50627789 TTTCCAGAATGTCATATAGTTGG - Intronic
1108753735 13:53475306-53475328 CAGTTAAAATGCCATATGGTAGG + Intergenic
1109413829 13:62009360-62009382 TTTTCAGAATGTCATACAGTTGG + Intergenic
1109570978 13:64189505-64189527 TTTTCAGAATGTCATATAATTGG - Intergenic
1110314589 13:74091396-74091418 CTCCTAGAATGTTATACAGTTGG + Intronic
1110903336 13:80853134-80853156 TTTCCAGAATGTCATATAGTTGG + Intergenic
1111228595 13:85310054-85310076 TTCTGAGAATGTCATATAGTTGG - Intergenic
1111264344 13:85787904-85787926 TTTCTAGAATGTCATAGAGTTGG - Intergenic
1111314972 13:86543680-86543702 TTTCCAGAATGTCATATAGTTGG - Intergenic
1111482044 13:88842421-88842443 ATGCTAGAATGTCATATAGTTGG - Intergenic
1111482049 13:88842473-88842495 TTTCCAGAATGTCATATAGTTGG - Intergenic
1111652104 13:91104333-91104355 TTTCTAGAATGCCATATAGTTGG - Intergenic
1112591352 13:100766064-100766086 CTGATAAAATGTCATAGAGAAGG + Intergenic
1113475513 13:110577878-110577900 TTTCTAGAATGTCATATGGTTGG + Intergenic
1113489729 13:110681845-110681867 TTTCTAGAATGTCATATAGTTGG - Intronic
1113873031 13:113574355-113574377 TTTCTAGAATGTCATAGAGTTGG - Intergenic
1114134571 14:19833573-19833595 TTTCTAGAATGTCATATAATTGG + Intergenic
1114239397 14:20852361-20852383 TTTCCAGAATGTCATATAGTTGG - Intergenic
1114293139 14:21305273-21305295 CTTCTAGAATGTCATATAGTTGG + Intronic
1114868517 14:26628034-26628056 TTTTCAGAATGTCATATAATTGG - Intergenic
1115559652 14:34571534-34571556 TTTCTAGAATGTTATATAGTTGG - Intronic
1115571825 14:34674032-34674054 TTTCTAGAATGTCATATAATTGG - Intergenic
1115833962 14:37376380-37376402 TTTCCAGAATGTCATATAGTTGG + Intronic
1116356188 14:43934714-43934736 TTTTCAGCATGTCATATAGTTGG - Intergenic
1116372057 14:44148806-44148828 TTTCTAGACTGTCATATAGTTGG - Intergenic
1116839490 14:49805154-49805176 CTGTGATATTGTCATATAGGGGG - Intronic
1117085680 14:52197808-52197830 TTTCCAGAATGTCATATAGTTGG - Intergenic
1117389737 14:55251297-55251319 TTTCTAGAATGTCATATACTTGG - Intergenic
1117421677 14:55552720-55552742 CTTCCAAAATGTCATATAGTCGG - Intergenic
1117763144 14:59053625-59053647 TTTCCAGAATGTCATATAGTTGG - Intergenic
1117780897 14:59230664-59230686 CTGTTATGCTGTCAAATAGTAGG - Intronic
1117787781 14:59305009-59305031 CTTTCAGAATGTCATAAAGTAGG - Intronic
1117801885 14:59453001-59453023 TTTCCAGAATGTCATATAGTTGG - Intronic
1118369004 14:65120174-65120196 CTTTTAGAATGTCATGTAAATGG + Intergenic
1118826952 14:69392444-69392466 TTTCCAGAATGTCATATAGTTGG - Intronic
1119280180 14:73400197-73400219 TTTCCAGAATGTCATATAGTTGG - Intronic
1119737092 14:76989780-76989802 TTTCCAGAATGTCATATAGTTGG + Intergenic
1120658463 14:87224417-87224439 TACTTAGAATGTCATATAGTTGG - Intergenic
1120658464 14:87224478-87224500 TACTTAAAATGTCATATAGTTGG - Intergenic
1120658468 14:87224539-87224561 TTTCCAGAATGTCATATAGTTGG - Intergenic
1120737866 14:88075628-88075650 TTTCCAGAATGTCATATAGTTGG - Intergenic
1120751878 14:88205108-88205130 TTTCTAGAATGTCATGTAGTTGG + Intronic
1120837422 14:89054012-89054034 TTTCTAGAATGTCGTATAGTTGG - Intergenic
1120908073 14:89638386-89638408 CTTCCAGAATGTCGTATAGTTGG - Intronic
1121258757 14:92551175-92551197 CTGTTTGAACTTCATATAGATGG + Intronic
1121290091 14:92767198-92767220 TTTCCAGAATGTCATATAGTTGG + Intergenic
1121291127 14:92776394-92776416 TTTCCAGAATGTCATATAGTTGG - Intergenic
1121301197 14:92872682-92872704 TTTCCAGAATGTCATATAGTTGG - Intergenic
1121301330 14:92873832-92873854 TTTCCAGAATGTCATATAGTTGG - Intergenic
1122851353 14:104533635-104533657 TTTTCAGAATGTCATATATTTGG + Intronic
1124429827 15:29597188-29597210 TTTCCAGAATGTCATATAGTTGG + Intergenic
1125060316 15:35412750-35412772 TTTCCAGAATGTCATATAGTTGG - Intronic
1125119891 15:36143274-36143296 TTTCTGGAATGTCATATAGTTGG - Intergenic
1126596199 15:50386447-50386469 TTTCCAGAATGTCATATAGTTGG - Intergenic
1127247574 15:57194431-57194453 CTGTGTAAATGTCATTTAGTGGG + Intronic
1127574373 15:60275604-60275626 TTGCTAGAATGTCATGTAGTTGG + Intergenic
1127739558 15:61888624-61888646 TTTTCAGAATTTCATATAGTTGG - Intronic
1128463057 15:67885662-67885684 TTTCCAGAATGTCATATAGTCGG + Intergenic
1128851444 15:70961670-70961692 TTTCTAGAATGTCATATAATTGG - Intronic
1128934575 15:71734420-71734442 TTTCTAGAATGTCATATAGTTGG - Intronic
1129094177 15:73185058-73185080 TTTCTAGAATGTCATGTAGTTGG - Intronic
1129632578 15:77277777-77277799 TTTTCAGAATGTCATATAGTTGG - Intronic
1129996693 15:80012820-80012842 TTTCTAGAATGTCATATAGTTGG + Intergenic
1130163849 15:81431944-81431966 TTTCCAGAATGTCATATAGTTGG + Intergenic
1130204633 15:81864679-81864701 TTTCCAGAATGTCATATAGTTGG - Intergenic
1130741649 15:86607032-86607054 TTTCCAGAATGTCATATAGTTGG + Intronic
1130950789 15:88585819-88585841 TTTCTAGAATGTCATACAGTTGG - Intergenic
1131320060 15:91379899-91379921 TTTCCAGAATGTCATATAGTTGG + Intergenic
1131633404 15:94203913-94203935 TTTCCAGAATGTCATATAGTTGG - Intergenic
1131892424 15:96986046-96986068 TTTTCAGAATGTCATGTAGTTGG + Intergenic
1133238327 16:4399978-4400000 TTTCCAGAATGTCATATAGTTGG - Intronic
1133920968 16:10152860-10152882 TTTCCAGAATGTCATATAGTTGG - Intronic
1135243814 16:20836348-20836370 GTTTTAGAAAGTCACATAGTTGG + Intronic
1135690541 16:24533822-24533844 TTTCTAGAATGTCATATAGTTGG - Intergenic
1135815663 16:25630506-25630528 ATGTTAGAATATTATATAGAAGG + Intergenic
1135847923 16:25935536-25935558 TTTCCAGAATGTCATATAGTTGG + Intronic
1135854011 16:25989997-25990019 TTTTCAGAATGACATATAGTTGG + Intronic
1136932108 16:34428210-34428232 TTTTCAGAATGTCAAATAGTTGG - Intergenic
1136972464 16:34983605-34983627 TTTTCAGAATGTCAAATAGTTGG + Intergenic
1137443749 16:48519223-48519245 TTTCCAGAATGTCATATAGTTGG - Intergenic
1137657507 16:50172876-50172898 TTTACAGAATGTCATATAGTTGG + Intronic
1138306701 16:55983496-55983518 CTTTCAAAATGTCATATAGTTGG + Intergenic
1138342615 16:56300406-56300428 CTGTTACTATGTCACACAGTTGG - Intronic
1138964637 16:62069282-62069304 CTTCTAGAATGTCATATAGTTGG + Intergenic
1138986323 16:62333239-62333261 CTTTTACATTGTCATAAAGTGGG - Intergenic
1139181314 16:64751783-64751805 CTGCTAGAATGTCATCTGGGGGG - Intergenic
1139232836 16:65303051-65303073 TTTATAGAATGTCATATACTTGG - Intergenic
1139498112 16:67336059-67336081 TTTTCAGAATGTCATATAGTTGG + Intronic
1139499982 16:67354978-67355000 TTTCCAGAATGTCATATAGTTGG + Intronic
1140335369 16:74099924-74099946 TTTCCAGAATGTCATATAGTTGG - Intergenic
1140462730 16:75153918-75153940 TTTCTAGAATGTCATATAGTTGG + Intronic
1140709300 16:77661639-77661661 TTTCCAGAATGTCATATAGTTGG + Intergenic
1143228203 17:5326412-5326434 CTTCTAGAATGTCATATGCTTGG - Intronic
1143255113 17:5551252-5551274 CTTCCAGAATGTCATATAGTTGG + Intronic
1143422915 17:6809708-6809730 TTTCTAGAATGTCATATAGTTGG + Intronic
1144048200 17:11472151-11472173 TTTCTGGAATGTCATATAGTTGG + Intronic
1144314218 17:14044064-14044086 TTTCTAGAATGTCATATACTTGG + Intergenic
1144373450 17:14615656-14615678 TTTTCAGAATGTCATATAGTTGG + Intergenic
1145108294 17:20138589-20138611 TTCCTAGAATGTCACATAGTTGG + Intronic
1145199574 17:20931000-20931022 TTTCCAGAATGTCATATAGTTGG - Intergenic
1146759696 17:35466372-35466394 TTTACAGAATGTCATATAGTTGG + Intronic
1147506541 17:41023263-41023285 TTTTCAGAATGTCATATACTTGG + Intergenic
1147698156 17:42372476-42372498 TTTCCAGAATGTCATATAGTTGG - Intronic
1148398553 17:47331792-47331814 TTTCCAGAATGTCATATAGTTGG + Intronic
1149364409 17:55927505-55927527 CTTTTAAAAGCTCATATAGTTGG + Intergenic
1149762773 17:59247444-59247466 TTTCCAGAATGTCATATAGTTGG + Intronic
1149917908 17:60628572-60628594 TTTCCAGAATGTCATATAGTTGG + Intronic
1150203667 17:63383428-63383450 TTCCCAGAATGTCATATAGTTGG + Intronic
1150688167 17:67337446-67337468 TTTTCAGAATGTCATATAGTTGG - Intergenic
1151142827 17:72011292-72011314 CTTTTCTAAGGTCATATAGTTGG + Intergenic
1151150634 17:72083115-72083137 TTTTCAGAATGTCATATAGTTGG - Intergenic
1153120350 18:1717179-1717201 TTTCCAGAATGTCATATAGTTGG - Intergenic
1153592576 18:6689240-6689262 TTCTGAGAATGTCCTATAGTTGG - Intergenic
1154958180 18:21280267-21280289 TTCCCAGAATGTCATATAGTTGG + Intronic
1155417015 18:25609824-25609846 TTTCCAGAATGTCATATAGTTGG - Intergenic
1155593049 18:27450181-27450203 TTCCTAGAATGTCATGTAGTTGG + Intergenic
1155858417 18:30865172-30865194 TTTCCAGAATGTCATATAGTTGG - Intergenic
1155921323 18:31605930-31605952 CTGTTATACTATCAAATAGTAGG - Intergenic
1156531232 18:37818341-37818363 TTTAGAGAATGTCATATAGTTGG - Intergenic
1156747088 18:40405383-40405405 CTTCCAGAATGTCATATAGTTGG + Intergenic
1156885742 18:42133392-42133414 TTTCCAGAATGTCATATAGTTGG + Intergenic
1156926660 18:42589019-42589041 TTTTTAGAATGTCATATATTTGG + Intergenic
1157044668 18:44086907-44086929 TTTTCAGAATGTCATATAGTTGG - Intergenic
1157501227 18:48192233-48192255 TTTCCAGAATGTCATATAGTTGG - Intronic
1158234840 18:55301260-55301282 CTGGTTGAATGTAATACAGTAGG + Intronic
1158485278 18:57860680-57860702 CTGCTATAAAGTCATATATTTGG - Intergenic
1158641931 18:59211234-59211256 TTTTTAGAATTTCATATAGATGG - Intergenic
1159373120 18:67555196-67555218 TTTCCAGAATGTCATATAGTTGG + Intergenic
1159409398 18:68052016-68052038 TTTCCAGAATGTCATATAGTTGG + Intergenic
1159773213 18:72573505-72573527 TTATTAGATTGTTATATAGTTGG + Intronic
1159836694 18:73345519-73345541 TTTCTAGAATGTCACATAGTTGG + Intergenic
1159907762 18:74113219-74113241 TTTTTAGAATATCATATGGTTGG - Intronic
1162247144 19:9410844-9410866 TTTTCAGAATGTCATAGAGTTGG - Intergenic
1164003572 19:21129498-21129520 ATGGTAGAATGTCATAAGGTGGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1166179588 19:41098223-41098245 TTTCCAGAATGTCATATAGTTGG - Intergenic
1166289894 19:41856208-41856230 TTTCCAGAATGTCATATAGTTGG + Intergenic
1166290064 19:41857202-41857224 TTTCCAGAATGTCATATAGTTGG - Intergenic
1167785854 19:51635784-51635806 CTGTTAGAAAATAATATAGCAGG + Intronic
1167977353 19:53240613-53240635 TTTTCAGAATGTCATATAGTTGG - Intronic
1168158999 19:54495998-54496020 CTTCCAGAATGTCACATAGTTGG - Intergenic
926023202 2:9515225-9515247 TTTCTAGAATGTCATATATTTGG + Intronic
926040861 2:9671937-9671959 TTTCCAGAATGTCATATAGTTGG + Intergenic
926470968 2:13257509-13257531 CTTACAGAATGCCATATAGTTGG + Intergenic
926614851 2:14985874-14985896 GTGTTTACATGTCATATAGTGGG + Intergenic
926630573 2:15132347-15132369 TTTCCAGAATGTCATATAGTTGG - Intergenic
926838163 2:17047430-17047452 CTGCCTGAATGTTATATAGTTGG + Intergenic
926877761 2:17502537-17502559 TTTCCAGAATGTCATATAGTTGG - Intergenic
926900301 2:17743809-17743831 TTTTCAGAACGTCATATAGTTGG + Intronic
927034080 2:19154740-19154762 TTTCTAGAATGTCATATAATTGG - Intergenic
927535122 2:23850576-23850598 TTTCCAGAATGTCATATAGTTGG - Intronic
928285134 2:29983633-29983655 TTTCTAGAATGTCATATAGTTGG + Intergenic
928338821 2:30423475-30423497 TTGGTAGGATGTCATATATTAGG + Intergenic
929066984 2:37987462-37987484 TTCCCAGAATGTCATATAGTTGG - Intronic
929095365 2:38258463-38258485 TGTCTAGAATGTCATATAGTTGG + Intergenic
930331675 2:49993333-49993355 CTTCTAGAATGTCATATGGTTGG - Intronic
930440911 2:51404090-51404112 TTTTCAAAATGTCATATAGTTGG + Intergenic
930496711 2:52154701-52154723 TTTTCAGAATGTCATACAGTCGG - Intergenic
931241550 2:60457868-60457890 CTGCTAGAATGTCACATGGATGG - Exonic
931531901 2:63224657-63224679 TTTCTAGAATGTCACATAGTTGG - Intronic
931770660 2:65494463-65494485 TTTCTAGAATGTCATATAGTTGG + Intergenic
931785401 2:65613522-65613544 CTGTCAGATTTTCATATGGTTGG + Intergenic
931935263 2:67189666-67189688 TTTCTAGAATGTCATGTAGTTGG + Intergenic
932000999 2:67884519-67884541 CTGTTAGAATTTTAAATAATTGG - Intergenic
932058738 2:68473243-68473265 TTTTCAGAATGTCATAGAGTTGG + Intronic
932515655 2:72345601-72345623 TATCTAGAATGTCATATAGTTGG - Intronic
932714118 2:74089221-74089243 CTGTGAGAATGTCACATAAATGG + Intronic
932786423 2:74608306-74608328 TTTCCAGAATGTCATATAGTTGG + Intronic
933084066 2:78032719-78032741 TTTTCAGAATATCATATAGTTGG - Intergenic
933226914 2:79760425-79760447 CTGTCAGACTGTCCTATAGATGG - Intronic
933865542 2:86513278-86513300 TTTCTAGAATGTCATATAGTTGG - Intronic
933880257 2:86662710-86662732 CTGTTAGAATATCAAATAATTGG - Intronic
935248382 2:101239023-101239045 CTGTTAGACTGGGATAGAGTTGG + Intronic
935257616 2:101326212-101326234 TTTCAAGAATGTCATATAGTTGG - Intergenic
935317651 2:101852336-101852358 CTGTTAAGATGTCATATGCTAGG + Intronic
935459557 2:103313056-103313078 TTTTCAGAAGGTCATATAGTTGG + Intergenic
935682421 2:105649476-105649498 TTTCCAGAATGTCATATAGTTGG - Intergenic
936229948 2:110691947-110691969 ATGGTAGAATGTCATAAGGTGGG - Intergenic
936459491 2:112702353-112702375 TTTTGAGAATGTCATGTAGTTGG + Intergenic
936664832 2:114582178-114582200 TTTCCAGAATGTCATATAGTTGG + Intronic
936774696 2:115958571-115958593 CTTCTAGAATGTCATATAGTTGG + Intergenic
936860219 2:117008064-117008086 TTTTCATAATGTCATATAGTTGG - Intergenic
937137576 2:119567337-119567359 TTTTCAGAATGTCATATAGTTGG + Intronic
937180707 2:119993709-119993731 TTTCTAGAATGTCATACAGTTGG - Intergenic
937850711 2:126632620-126632642 TTTCTAGAATGTCATACAGTTGG - Intergenic
938785518 2:134625018-134625040 TTGTTAAAATGTAATATACTAGG - Intronic
940350948 2:152687517-152687539 TTCTAAGAATTTCATATAGTTGG - Intronic
940425041 2:153521758-153521780 TTCCTAGAATGTCATATAGTTGG + Intergenic
940429299 2:153569756-153569778 CTGTTATATTATCAAATAGTAGG + Intergenic
940539739 2:154996967-154996989 TTTCTAGAATGCCATATAGTTGG - Intergenic
940579859 2:155564780-155564802 CATCTAGAATGTCATATACTTGG + Intergenic
940949483 2:159656556-159656578 TTTGCAGAATGTCATATAGTTGG + Intergenic
940977765 2:159965365-159965387 TTTCCAGAATGTCATATAGTTGG + Intronic
941570616 2:167165065-167165087 TTTCTAGAATGTCATATAGTTGG + Intronic
941706730 2:168666378-168666400 TTTTCAGAATGTCATATAATTGG + Intronic
941717396 2:168778551-168778573 TTTCCAGAATGTCATATAGTTGG - Intergenic
941750585 2:169131097-169131119 ATGCTTGAATGTCATATATTTGG - Intronic
941888671 2:170555505-170555527 TTTTCAGAATGTCATATAGTTGG + Intronic
942111987 2:172691633-172691655 TTTGCAGAATGTCATATAGTTGG + Intergenic
942198908 2:173551426-173551448 TTTCCAGAATGTCATATAGTTGG - Intergenic
942504529 2:176627684-176627706 TTTCCAGAATGTCATATAGTTGG - Intergenic
943085642 2:183307610-183307632 CTCTGAGAATGGAATATAGTGGG + Intergenic
943234258 2:185297755-185297777 TTTTCAGATTGTCATATAGTTGG + Intergenic
943464573 2:188213204-188213226 TTTCCAGAATGTCATATAGTTGG + Intergenic
943857298 2:192813691-192813713 TTTTCAGAATGTCATATAGTTGG + Intergenic
944276240 2:197841433-197841455 TTTTCAGAATGTCATATAGTTGG + Intronic
944379775 2:199094804-199094826 CTTCCAGAATATCATATAGTTGG - Intergenic
944562173 2:200951087-200951109 TTTCCAGAATGTCATATAGTTGG + Intronic
944603859 2:201331628-201331650 TTTTCAGAATGTCATATAGTTGG - Intronic
945021394 2:205575594-205575616 CTTTTAGTATGTCATATGCTTGG + Intronic
945527875 2:210911312-210911334 TTTTCAGAATGTCATATAATTGG - Intergenic
945534605 2:210999181-210999203 TCTTTAGAATGTCATATAGTTGG + Intergenic
946711655 2:222512697-222512719 TTTCTAGAATGTCATATAGTTGG + Intronic
946917447 2:224539725-224539747 TTTCCAGAATGTCATATAGTTGG - Intronic
946997559 2:225412394-225412416 CTGTTAGAGTGTCCTTGAGTGGG + Intronic
947292452 2:228591766-228591788 CAGTTAGAAAGTCATTTAGAAGG - Intergenic
947495209 2:230631057-230631079 TTTTCAGAATGTCATATAGTTGG - Intergenic
947570742 2:231232322-231232344 CTCTTAGAATGTGATAAATTTGG - Intronic
1168988845 20:2077115-2077137 TTTCCAGAATGTCATATAGTTGG - Intergenic
1170357713 20:15510278-15510300 TTGTTAGAATGTCCTTCAGTAGG - Intronic
1170365138 20:15589742-15589764 TTTCCAGAATGTCATATAGTTGG + Intronic
1170378016 20:15723506-15723528 TTCTAAGAATGTCATATAGTTGG + Intronic
1170519312 20:17167396-17167418 TTTCTAGAATGTCATGTAGTTGG + Intergenic
1170636345 20:18108108-18108130 TTTCCAGAATGTCATATAGTTGG + Intergenic
1170689359 20:18598923-18598945 TTTTTAGAATGTCATATATTTGG + Intronic
1170851831 20:20011813-20011835 CTTTCAGAATGTCATATAAATGG + Intergenic
1171140883 20:22741497-22741519 TTTTCAGAATGTCATGTAGTTGG - Intergenic
1171178061 20:23069688-23069710 TTTCTAGAGTGTCATATAGTTGG - Intergenic
1171441197 20:25164595-25164617 CTGTTAGAAAGTGACATACTTGG + Intergenic
1171468045 20:25346246-25346268 TTTACAGAATGTCATATAGTTGG - Intronic
1172927964 20:38557582-38557604 TTTTCAGAATGTCATATAGTTGG + Intronic
1173178646 20:40784882-40784904 CTGTTGTACTGTCAAATAGTAGG + Intergenic
1173194572 20:40903799-40903821 TTTCCAGAATGTCATATAGTTGG - Intergenic
1173234384 20:41231086-41231108 TTTTCAGAATGTCATATAGTTGG + Intronic
1175614254 20:60379713-60379735 ATTTTAGAATGTCATATGGTTGG - Intergenic
1176699570 21:10027987-10028009 CTATTGGAATGTCATATAAATGG - Intergenic
1177283085 21:19010568-19010590 TTTCTAGAATGTCATATAGTTGG - Intergenic
1177456765 21:21349991-21350013 CTGTTGGACTATCAAATAGTAGG - Intronic
1177638857 21:23820420-23820442 CTTCCAGAATGTCATATAATTGG - Intergenic
1177724131 21:24945195-24945217 CTGTTTCATTGTCACATAGTTGG - Intergenic
1177826710 21:26092444-26092466 TTTCCAGAATGTCATATAGTGGG - Intronic
1177846863 21:26299762-26299784 TTTCTAGAATGTCATATAGTTGG - Intergenic
1178115929 21:29416434-29416456 TTTTCAGAATGTCATATGGTTGG + Intronic
1178220434 21:30651635-30651657 TTATGAGAATGCCATATAGTTGG - Intergenic
1178628911 21:34242508-34242530 TTTCCAGAATGTCATATAGTTGG - Intergenic
1179038392 21:37780235-37780257 TTTGCAGAATGTCATATAGTTGG - Intronic
1179055665 21:37930530-37930552 TTTTTAGAATGTCATATAAATGG - Intergenic
1179278257 21:39911316-39911338 CTGTTTTACTGTCAGATAGTTGG - Intronic
1179351124 21:40611884-40611906 CTGTTTAAATGTCACTTAGTAGG - Intronic
1180034571 21:45237928-45237950 TTTTCAAAATGTCATATAGTTGG - Intergenic
1180116742 21:45711992-45712014 TTTCCAGAATGTCATATAGTTGG + Intronic
1180129575 21:45818932-45818954 TTTCCAGAATGTCATATAGTTGG - Intronic
1180760062 22:18195115-18195137 TTTCCAGAATGTCATATAGTTGG - Intergenic
1180770374 22:18379414-18379436 TTTCCAGAATGTCATATAGTTGG - Intergenic
1180775606 22:18429585-18429607 TTTCCAGAATGTCATATAGTTGG + Intergenic
1180808679 22:18740622-18740644 TTTCCAGAATGTCATATAGTTGG + Intergenic
1180828315 22:18882367-18882389 TTTCCAGAATGTCATATAGTTGG - Intergenic
1181071606 22:20345596-20345618 TTTCCAGAATGTCATATAGTTGG + Intergenic
1181194676 22:21174538-21174560 TTTCCAGAATGTCATATAGTTGG + Intergenic
1181214768 22:21318232-21318254 TTTCCAGAATGTCATATAGTTGG - Intergenic
1181483608 22:23217206-23217228 CTGTTGCCATGTTATATAGTAGG + Intronic
1181743011 22:24936305-24936327 TTGATAGAATGGAATATAGTTGG - Intronic
1182037654 22:27211947-27211969 CTTTAAGAATGTCATATAAATGG - Intergenic
1182694658 22:32189178-32189200 TTTCTAGAATGTCATATAGTTGG + Intergenic
1184427415 22:44420061-44420083 TTTTTTGAATGTCATATAATTGG + Intergenic
1184634027 22:45811946-45811968 CTTTTAGAATGTGATAGACTAGG - Intronic
1203232207 22_KI270731v1_random:120598-120620 TTTCCAGAATGTCATATAGTTGG - Intergenic
1203278412 22_KI270734v1_random:108372-108394 TTTCCAGAATGTCATATAGTTGG - Intergenic
949286951 3:2417907-2417929 TTTCCAGAATGTCATATAGTTGG - Intronic
949358674 3:3208668-3208690 TTTGCAGAATGTCATATAGTTGG - Intergenic
950402678 3:12781988-12782010 TTTATAGAATGTCATATAGTTGG - Intergenic
951000043 3:17548012-17548034 TTGTTAAAATTTCATATAGCAGG + Intronic
951416888 3:22435114-22435136 TTTTCAGAATGTCATATAGTGGG - Intergenic
951479973 3:23149991-23150013 TTTTCAGAATGTCATATAGTTGG - Intergenic
951558357 3:23943542-23943564 TTTCTAGAATGTCGTATAGTTGG + Intronic
951630896 3:24719033-24719055 CTGACAGAATGTGATCTAGTTGG - Intergenic
952563859 3:34631572-34631594 TTTCCAGAATGTCATATAGTTGG + Intergenic
952785304 3:37148725-37148747 GTGTTAGAATAAAATATAGTTGG - Intronic
954058499 3:48048989-48049011 CTTTGAGAATGTCATATAAATGG + Intronic
954203818 3:49042475-49042497 TTTCCAGAATGTCATATAGTTGG - Intronic
954494464 3:50941824-50941846 CTATGAGAATGTCATATAAATGG - Intronic
955203167 3:56870393-56870415 TTTTCAGAATGCCATATAGTTGG - Intronic
955262989 3:57413210-57413232 TTTTCAGAATGTCATATAGTTGG - Intronic
955634718 3:61014930-61014952 CTTTTAAAATGTCATATATATGG - Intronic
956035423 3:65085411-65085433 TTTCCAGAATGTCATATAGTTGG + Intergenic
957485412 3:80855390-80855412 TTTCCAGAATGTCATATAGTTGG + Intergenic
957515126 3:81240359-81240381 TTGTTAGGATGTCATCTCGTAGG + Intergenic
957628230 3:82682543-82682565 TTTTCAGAATGTCATCTAGTTGG + Intergenic
957859158 3:85921898-85921920 TTTCTAGAATGTCATATAATGGG + Intronic
958001810 3:87760653-87760675 TTTCCAGAATGTCATATAGTTGG - Intergenic
958481256 3:94648377-94648399 CTGTTAGACTGGGATAGAGTTGG + Intergenic
959257006 3:104028170-104028192 TTTTTAGAATTTCATATAGTTGG + Intergenic
959640687 3:108629226-108629248 CTGTAAGAATATGATATAGTTGG - Intronic
959755445 3:109892603-109892625 CTGTTAAATAGTCATTTAGTTGG + Intergenic
959980019 3:112505533-112505555 TTCCCAGAATGTCATATAGTTGG + Intergenic
960213664 3:115003078-115003100 TTTCCAGAATGTCATATAGTTGG - Intronic
960220647 3:115104637-115104659 TTTTCAGAATGTCATATAGTTGG - Intronic
960281950 3:115790146-115790168 CTGTTAGCATGTAATATTCTTGG + Intergenic
960370220 3:116827258-116827280 CACTAAGAATTTCATATAGTGGG + Intronic
960634566 3:119770313-119770335 CTTTTAGGATGTCATACAGAAGG - Intergenic
960659893 3:120046002-120046024 TTTTCAGAATGTCCTATAGTTGG - Intronic
960893824 3:122480088-122480110 TTTCCAGAATGTCATATAGTTGG - Intronic
960895807 3:122503870-122503892 CTTCCAGAATGTCATATAATTGG - Intronic
961029936 3:123592985-123593007 TTTCCAGAATGTCATATAGTTGG + Intergenic
961462448 3:127060684-127060706 TTCCTAGAATGTCATACAGTTGG + Intergenic
961497169 3:127302346-127302368 TTTCTAGAATGTCATATAATTGG + Intergenic
961691358 3:128672162-128672184 TTTCCAGAATGTCATATAGTTGG + Intronic
962489815 3:135882341-135882363 TTTCTAGAATGTCATGTAGTTGG - Intergenic
962524400 3:136224197-136224219 CTGTTAAAAAGTCATATGGTAGG - Intergenic
962568221 3:136685707-136685729 TTTCCAGAATGTCATATAGTTGG - Intronic
962590579 3:136885860-136885882 TTTTTAGAATGTTATAAAGTTGG + Intronic
962621442 3:137183928-137183950 TTTCCAGAATGTCATATAGTTGG + Intergenic
962658746 3:137578923-137578945 TTTCCAGAATGTCATATAGTTGG - Intergenic
962718112 3:138145791-138145813 TTTCCAGAATGTCATATAGTTGG - Intergenic
962822464 3:139064578-139064600 TTTCTAGAATGTCATATAGTTGG + Intronic
963235502 3:142952060-142952082 TTGTTAGAGTGTGACATAGTGGG + Intronic
963465243 3:145671596-145671618 TTTACAGAATGTCATATAGTTGG - Intergenic
964300796 3:155283077-155283099 ATGATAGAATGTCATAAGGTGGG + Intergenic
964460996 3:156928070-156928092 TTTCCAGAATGTCATATAGTTGG - Intronic
964536989 3:157733445-157733467 TTTCCAGAATGTCATATAGTTGG - Intergenic
964739330 3:159949165-159949187 TTGCCAGAATGTCATAGAGTTGG - Intergenic
964800182 3:160547781-160547803 TTTAAAGAATGTCATATAGTTGG + Intronic
964818549 3:160743795-160743817 TTTCCAGAATGTCATATAGTTGG + Intergenic
965152023 3:164989852-164989874 TTTCCAGAATGTCATATAGTTGG - Intronic
965162447 3:165151938-165151960 TAGTTATAATGTAATATAGTAGG + Intergenic
965231116 3:166054076-166054098 TTTTGAGAATGTCATATATTTGG + Intergenic
965283594 3:166786368-166786390 TTTTAAGAATGTCATATAGTTGG - Intergenic
966194033 3:177296227-177296249 TTCTCAGAATGTCATATAGTTGG + Intergenic
966295562 3:178417556-178417578 TTTCCAGAATGTCATATAGTTGG + Intergenic
966545988 3:181149054-181149076 TTTTCAGTATGTCATATAGTTGG - Intergenic
966965473 3:184987451-184987473 CTTCCAGAATGTCATATAGTTGG + Intronic
967363663 3:188661059-188661081 TTATCAGAATGTCTTATAGTTGG + Intronic
967372224 3:188759674-188759696 CAGTTAGAATGTAAGATAATTGG - Intronic
967520617 3:190428109-190428131 TTTTTAGAATGCCCTATAGTTGG - Intergenic
967780390 3:193432660-193432682 TTTCTAGAATGTTATATAGTTGG - Intronic
968227319 3:196981613-196981635 TTTCCAGAATGTCATATAGTTGG - Intergenic
969109597 4:4835471-4835493 TTTCTAGAATGTTATATAGTTGG - Intergenic
969357154 4:6635441-6635463 TTCCTAGAATGTCATACAGTTGG + Intergenic
969647961 4:8444347-8444369 CTGTTAGACTATCATATACTAGG - Intronic
970119406 4:12735858-12735880 TTTCCAGAATGTCATATAGTTGG + Intergenic
970226608 4:13864860-13864882 TTTTCAGAATGTCATATAGTTGG + Intergenic
970325006 4:14914221-14914243 CTGTTATAATGCCTTGTAGTGGG - Intergenic
970545103 4:17121368-17121390 TTTCCAGAATGTCATATAGTTGG - Intergenic
970632591 4:17967179-17967201 TTTTTAGAATGTCATATAGTTGG - Intronic
970924019 4:21429199-21429221 TTTCAAGAATGTCATATAGTTGG + Intronic
971189250 4:24411736-24411758 TTTCCAGAATGTCATATAGTTGG + Intergenic
971433256 4:26591117-26591139 TTTTAAGAATGTCATATAGTTGG + Intronic
971886896 4:32462281-32462303 CAGTTAAAATGTCAAACAGTTGG + Intergenic
971904696 4:32711284-32711306 TTTCCAGAATGTCATATAGTTGG + Intergenic
972406331 4:38750204-38750226 TTTTCAGAATGTCATATAGTTGG + Intergenic
972912719 4:43838042-43838064 TTTCTAGAATGTCATATAGCTGG + Intergenic
973117657 4:46481160-46481182 CTGTTAGAATGTGACAGAGCTGG - Intergenic
973146042 4:46827853-46827875 CTTCTAGAATGTCATATAAATGG - Intronic
973235437 4:47897801-47897823 TTTCCAGAATGTCATATAGTTGG + Intronic
973331826 4:48917036-48917058 TTTCCAGAATGTCATATAGTTGG + Intergenic
975152671 4:71037649-71037671 TTTCTAGAATGTCATATACTTGG + Intergenic
975848734 4:78550491-78550513 TTTCTGGAATGTCATATAGTTGG + Intergenic
975958471 4:79871659-79871681 TTTTCAGAATGTCATACAGTTGG - Intergenic
976470445 4:85422114-85422136 TTTTCAAAATGTCATATAGTTGG + Intergenic
976650453 4:87428638-87428660 CTTCAAGAATGCCATATAGTTGG - Intronic
977296153 4:95211689-95211711 CGGTTAGAATATAAAATAGTTGG - Intronic
977374751 4:96187774-96187796 TATTTAGAATGTCATATAGTTGG + Intergenic
977861358 4:101964453-101964475 CTGTTAGAATGTCCTACTTTGGG + Intronic
977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG + Intronic
978135437 4:105252245-105252267 ATTCCAGAATGTCATATAGTTGG + Intronic
978415575 4:108472447-108472469 TTTCTAGTATGTCATATAGTTGG - Intergenic
978424649 4:108569520-108569542 TTTCCAGAATGTCATATAGTTGG - Intergenic
978930552 4:114305935-114305957 CTGTTTAAATGTCATATTGTAGG - Intergenic
979035946 4:115717688-115717710 TTTCTAGAATGTCATATAGAAGG + Intergenic
979266245 4:118706313-118706335 TTGTCAGAATGTTACATAGTTGG + Intronic
979529666 4:121756265-121756287 TTTTCAGAATGTCATATAATTGG - Intergenic
979943561 4:126794923-126794945 TTTCAAGAATGTCATATAGTTGG - Intergenic
980390462 4:132138943-132138965 TTTCTAGAATGTCATATAATTGG - Intergenic
980540268 4:134184462-134184484 TTTCCAGAATGTCATATAGTTGG + Intergenic
980690214 4:136286523-136286545 TTTTAAGACTGTCATATAGTTGG - Intergenic
980776304 4:137440940-137440962 TTTTCAAAATGTCATATAGTTGG - Intergenic
981492768 4:145358093-145358115 TTTTTAAAATGTCATTTAGTTGG - Intergenic
981792062 4:148549406-148549428 TTTCTAGAATGTCAGATAGTTGG - Intergenic
981802519 4:148674751-148674773 TTTTTAGAAAGTCATATAGTTGG + Intergenic
982146585 4:152401461-152401483 TTTCCAGAATGTCATATAGTTGG - Intronic
982169892 4:152651084-152651106 CTGTTAGAAGCTAATGTAGTTGG - Intronic
982211900 4:153044536-153044558 TTTCCAGAATGTCATATAGTTGG - Intergenic
982429213 4:155303419-155303441 TTTCAAGAATGTCATATAGTTGG - Intergenic
982839206 4:160160710-160160732 TTTCCAGAATGTCATATAGTTGG - Intergenic
983080927 4:163384505-163384527 CTTTTCCAGTGTCATATAGTTGG - Intergenic
983093341 4:163533275-163533297 TTTCTAGAATGTCACATAGTTGG - Intronic
983297612 4:165885861-165885883 CTGTTAACATGTCATGTACTTGG - Intronic
983378863 4:166966060-166966082 TTTCCAGAATGTCATATAGTTGG + Intronic
983926325 4:173406696-173406718 CTTCTAGAATGTCATATAATTGG + Intergenic
984236497 4:177165099-177165121 TTTCTAGAATGTCATATAGGTGG - Intergenic
984524745 4:180844784-180844806 TTGTCAGAATGTCATGTGGTTGG + Intergenic
984636515 4:182116256-182116278 TTTCCAGAATGTCATATAGTTGG + Intergenic
985236380 4:187879875-187879897 CTGTTAGAGTGTAATATCTTTGG + Intergenic
985927835 5:3031672-3031694 TTGTTGGAAAGTCATAAAGTTGG - Intergenic
985962769 5:3315336-3315358 TTTTCAGAATGTCATGTAGTTGG + Intergenic
986166318 5:5274425-5274447 TTTCCAGAATGTCATATAGTTGG + Intronic
986183420 5:5415426-5415448 TTTCTAGAATGCCATATAGTTGG + Intergenic
986272764 5:6248469-6248491 TTCCCAGAATGTCATATAGTTGG + Intergenic
986603020 5:9492789-9492811 TTTCTAGAATGTCATATATTTGG - Intronic
986973525 5:13367220-13367242 TTTTCAGAATGTCATAGAGTTGG - Intergenic
987420698 5:17717020-17717042 TTTCCAGAATGTCATATAGTTGG - Intergenic
987450644 5:18079548-18079570 TTTTTAGAATGTCATATACTTGG + Intergenic
987463685 5:18246800-18246822 TTTTCAGAATGTCATGTAGTTGG + Intergenic
987637955 5:20569945-20569967 CTCTCAGAATGTCATGTAGTTGG - Intronic
987666242 5:20944739-20944761 TTTTGAGAATGTCATATGGTTGG + Intergenic
987763059 5:22190669-22190691 CTCCTAGAATGTCATCTGGTAGG + Intronic
987839408 5:23203631-23203653 CCTCTTGAATGTCATATAGTTGG - Intergenic
988517949 5:31920836-31920858 TTTCCAGAATGTCATATAGTTGG + Intronic
988637214 5:32997509-32997531 TTTCTAGAATGTCATATGGTTGG + Intergenic
988756434 5:34257326-34257348 TTTTGAGAATGTCATATGGTTGG - Intergenic
988774703 5:34467311-34467333 CTGTTAGACTGGGATAGAGTTGG - Intergenic
988937203 5:36096319-36096341 TTTCCAGAATGTCATATAGTTGG + Intergenic
989381644 5:40814693-40814715 TTTTCAGAATGTCATATAATTGG + Intergenic
989436986 5:41425698-41425720 TTTTTAGAATGTCACATAGTTGG + Intronic
989804857 5:45590700-45590722 TTTCCAGAATGTCATATAGTTGG + Intronic
990216271 5:53535896-53535918 TTGCCAGAATGTCATATAGTTGG - Intergenic
990263596 5:54052058-54052080 TTTCTAGAATGTCATATAATTGG - Intronic
990275008 5:54185995-54186017 CTCGTAGTATGACATATAGTGGG + Intronic
990331835 5:54735216-54735238 CAGTTAGAATGTTATATTTTAGG - Intergenic
990372489 5:55134827-55134849 TTTCCAGAATGTCATATAGTTGG - Intronic
990555211 5:56927012-56927034 ATTTCAGAATGTCATATAGTTGG - Intronic
990971623 5:61513191-61513213 TTTCCAGAATGTCATATAGTTGG + Intronic
991114203 5:62935215-62935237 ATGTTAAAATGTCTTACAGTTGG + Intergenic
991897839 5:71424073-71424095 CTCCTAGAATGTCATCTGGTAGG + Intergenic
992633649 5:78706198-78706220 ACAATAGAATGTCATATAGTTGG + Intronic
993574828 5:89587910-89587932 CTGTTATAATATCATAGACTGGG + Intergenic
993975845 5:94479315-94479337 TTTTCATAATGTCATATAGTTGG + Intronic
994134953 5:96275448-96275470 TTGTTGGAATGTCATCCAGTTGG + Intergenic
994260132 5:97648217-97648239 TTTCTAGAATGTCATATAATTGG + Intergenic
994387093 5:99145573-99145595 TTTCCAGAATGTCATATAGTTGG - Intergenic
994526148 5:100906977-100906999 CTTTTCAAGTGTCATATAGTTGG + Intergenic
994593332 5:101800089-101800111 TTTCCAGAATGTCATATAGTTGG + Intergenic
994943147 5:106350519-106350541 TTTCTAGAAGGTCATATAGTTGG + Intergenic
994976200 5:106810294-106810316 ATTCCAGAATGTCATATAGTTGG + Intergenic
995410617 5:111853160-111853182 TTCCTAGAATGTTATATAGTTGG - Intronic
995632463 5:114149014-114149036 CTGTTAGACTGGGATAGAGTTGG - Intergenic
995800743 5:115991266-115991288 GTTCCAGAATGTCATATAGTTGG + Intronic
995821326 5:116236619-116236641 CTTCTAGAATGTCATATAGTTGG - Intronic
995912082 5:117199684-117199706 CTCTTAGAATGGCATCTATTGGG + Intergenic
996161201 5:120167830-120167852 TTTTTGGAATGTCATATACTTGG + Intergenic
996322197 5:122231467-122231489 TTTCCAGAATGTCATATAGTTGG - Intergenic
996373808 5:122781233-122781255 TTTCTAGAATGTCATATAGGTGG + Intronic
997399991 5:133594915-133594937 CTTTTAAAATGTCATTAAGTAGG - Intronic
997753436 5:136372155-136372177 TTTCCAGAATGTCATATAGTTGG - Intronic
997785849 5:136712817-136712839 TTTCTAGAATGTCATGTAGTTGG - Intergenic
998189362 5:140009879-140009901 TTTCCAGAATGTCATATAGTTGG - Intronic
998361850 5:141595093-141595115 TTTCTAGAATGTCATATAGTTGG - Intronic
998962257 5:147501233-147501255 TTTTCAGAGTGTCATATAGTGGG - Intronic
999189589 5:149737128-149737150 TTTCCAGAATGTCATATAGTTGG + Intronic
999695285 5:154183432-154183454 TTTCTAGAACGTCATATAGTTGG - Intronic
999740877 5:154550525-154550547 TTTTCAGAATGTCATACAGTTGG + Intergenic
999875795 5:155804346-155804368 CTGTTAGAAAGTGATAGAGGAGG + Intergenic
999987640 5:157019908-157019930 TTTTCAGAATGTCATATAATTGG - Intergenic
1000317849 5:160110295-160110317 CTGTTAAAATGTCAGACTGTTGG - Intronic
1000471508 5:161648142-161648164 TTTCTAGAATGTCAAATAGTTGG + Intronic
1001946816 5:175785994-175786016 TTTCCAGAATGTCATATAGTTGG + Intergenic
1002249245 5:177913953-177913975 TTTCCAGAATGTCATATAGTTGG + Intergenic
1004118217 6:12792012-12792034 CTGTTCAAATGTCACATTGTTGG - Intronic
1005002139 6:21252604-21252626 TTTCTAGAATGTCATGTAGTTGG + Intergenic
1006482934 6:34313276-34313298 CTCCTAGAATGTCTTATAGTTGG - Intronic
1007123544 6:39403377-39403399 TTTTCAGAATGTCATATAGCTGG + Intronic
1007365038 6:41385340-41385362 TTTCCAGAATGTCATATAGTTGG + Intergenic
1007883264 6:45191337-45191359 TTTTCAGAATTTCATATAGTTGG - Intronic
1008235399 6:49040677-49040699 TTTCTAGAATGTCATACAGTAGG + Intergenic
1008272590 6:49507343-49507365 CTGTTAGACTGGGATAGAGTTGG - Intronic
1008322878 6:50139467-50139489 TTTCTAGAATGTCACATAGTTGG + Intergenic
1008920163 6:56835113-56835135 TTTACAGAATGTCATATAGTTGG - Intronic
1009004037 6:57759584-57759606 TTTTTGGAATGTCATATAGTAGG + Intergenic
1009670096 6:66738089-66738111 CTGTAAGAAATTCATATAGTTGG + Intergenic
1009730284 6:67593808-67593830 TTTTCAGAATGTCATATAGTTGG - Intergenic
1009765614 6:68070998-68071020 CTTCCAGAATGTCATATAGTTGG - Intergenic
1010151558 6:72738823-72738845 TTTCCAGAATGTCATATAGTTGG - Intronic
1010348862 6:74847447-74847469 TTTCTAGAATGTCATATAGTTGG + Intergenic
1011007694 6:82665905-82665927 CTTTCAGAATGTTATATTGTTGG - Intergenic
1011023398 6:82839349-82839371 TTTTCAGAATGTCATATAATTGG - Intergenic
1011242115 6:85283491-85283513 TTTCTAGAATGTCATATACTTGG + Intergenic
1011566893 6:88684637-88684659 TTCTCAGAATATCATATAGTTGG - Intronic
1011672689 6:89698591-89698613 CTGTTTAAATGTTTTATAGTGGG + Intronic
1012105535 6:95153082-95153104 CTGTAAGAGTATCATATTGTAGG + Intergenic
1012253058 6:97000954-97000976 TTTCCAGAATGTCATATAGTTGG - Intronic
1012306911 6:97669760-97669782 CTGTAAGAATGTGAAATATTCGG - Intergenic
1012320943 6:97844684-97844706 TTTTCAGAATGTCATATTGTTGG + Intergenic
1012623680 6:101379673-101379695 TTTCCAGAATGTCATATAGTTGG + Intergenic
1012704886 6:102511444-102511466 CTTCTAGAATGTCATATTGTTGG + Intergenic
1012781252 6:103560407-103560429 TTTCCAGAATGTCATATAGTTGG + Intergenic
1012926014 6:105268672-105268694 TTTTCAGAATGCCATATAGTTGG - Intergenic
1013306763 6:108854956-108854978 TTGCCAGAATGTCATATAGTTGG + Intronic
1013675787 6:112460881-112460903 CTTTCAGAATGTCATATGGTTGG + Intergenic
1014058722 6:117046372-117046394 TTTTTAGAATGTAATATAATTGG - Intergenic
1014394570 6:120909620-120909642 TTTCCAGAATGTCATATAGTTGG + Intergenic
1014405263 6:121043267-121043289 CTGTTAGACTGGGATAGAGTTGG + Intergenic
1015049451 6:128821649-128821671 TTTACAGAATGTCATATAGTTGG - Intergenic
1016222612 6:141693569-141693591 CTTTTTAGATGTCATATAGTTGG - Intergenic
1016230849 6:141802044-141802066 TTTCTAGAATGTCATATAGTTGG - Intergenic
1016233806 6:141837108-141837130 TTTATAGAATGTCATAGAGTTGG - Intergenic
1016531629 6:145064883-145064905 CTGTTAGGTTGTCATAAAATGGG - Intergenic
1016945607 6:149529917-149529939 TTTTCAAAATGTCATATAGTTGG - Intronic
1017068758 6:150553123-150553145 TTCTCAGAAGGTCATATAGTGGG + Intergenic
1017157996 6:151339804-151339826 TTTTCAGAATGTCATATAGTTGG + Intronic
1017741577 6:157411256-157411278 CTGTGAGAATGTTATATAAATGG - Intronic
1018546660 6:164944578-164944600 TTTCCAGAATGTCATATAGTTGG - Intergenic
1018585540 6:165353654-165353676 TTTCCAGAATGTCATATAGTTGG - Intronic
1020438875 7:8196278-8196300 TTTTCAGAATGTCATATAATTGG - Intronic
1020498211 7:8883584-8883606 TTCTCAGAATGTCATATAATTGG - Intergenic
1020587836 7:10092755-10092777 TTTTAAGAATGTCATACAGTTGG + Intergenic
1020636769 7:10705553-10705575 TTCCCAGAATGTCATATAGTTGG - Intergenic
1021151256 7:17153148-17153170 TTCTTACAATGTCATGTAGTTGG - Intergenic
1022480095 7:30737454-30737476 TTTCCAGAATGTCATATAGTTGG + Intronic
1022625074 7:32026938-32026960 TTTCCAGAATGTCATATAGTTGG - Intronic
1023229940 7:38016722-38016744 CTGAAAGACTGTCAGATAGTAGG - Intronic
1023407908 7:39855354-39855376 TTTCTAGAATGTCATATAGTTGG + Intergenic
1023425414 7:40030737-40030759 TTTTCAGAATGTCATGTAGTTGG + Intronic
1023524600 7:41086596-41086618 TTTTCAGAATGTCACATAGTTGG + Intergenic
1023591082 7:41781057-41781079 TTACCAGAATGTCATATAGTTGG + Intergenic
1023902639 7:44494932-44494954 TTTTCAGAATGTCATATAATTGG - Intergenic
1023903399 7:44502747-44502769 TTTACAGAATGTCATATAGTTGG + Intergenic
1024132224 7:46365042-46365064 TTTCCAGAATGTCATATAGTTGG + Intergenic
1024713968 7:52053359-52053381 TTTCTAGAATGTCATATATTTGG + Intergenic
1024772421 7:52738786-52738808 TTTCCAGAATGTCATATAGTTGG + Intergenic
1024854789 7:53765408-53765430 ATTTCAGAATGTCATAAAGTTGG + Intergenic
1024866842 7:53913033-53913055 TTTATAGGATGTCATATAGTTGG + Intergenic
1025712222 7:63923013-63923035 TTTACAGAATGTCATATAGTTGG - Intergenic
1026071575 7:67125789-67125811 TTTCCAGAATGTCATATAGTTGG + Intronic
1026599376 7:71763164-71763186 TTTTTAGAATGTCATATAATTGG + Intergenic
1026705320 7:72686476-72686498 TTTCCAGAATGTCATATAGTTGG - Intronic
1026884283 7:73929252-73929274 TTTCCAGAATGTCATATAGTTGG + Intergenic
1027983595 7:85256821-85256843 TTTCTAGAATGTCATATAGTTGG + Intergenic
1028571653 7:92294758-92294780 TTGGTAAAATGTAATATAGTTGG + Intronic
1028770150 7:94610129-94610151 CTTCCAGAATGTCATATAATTGG - Intronic
1028926501 7:96362302-96362324 TTTTGAGAATGACATATAGTTGG + Intergenic
1028951449 7:96640497-96640519 TTTCCAGAATGTCATATAGTTGG - Intronic
1029801331 7:102950777-102950799 TTTCTGGAATGTCATATAGTTGG - Intronic
1029818287 7:103119827-103119849 CTGTGAGAATGTGATTGAGTTGG - Exonic
1029846204 7:103414487-103414509 TTTTTAGAATGTCATTCAGTTGG + Intronic
1030415868 7:109241637-109241659 ATGTTAAAATGTCATCTAGGAGG - Intergenic
1030556688 7:111033736-111033758 ATATCAGAATGTCATATAGTTGG - Intronic
1030585578 7:111414441-111414463 TTTTTAGAATGTCATTTAATTGG - Intronic
1030723867 7:112902059-112902081 TTTCCAGAATGTCATATAGTTGG - Intronic
1031328856 7:120437501-120437523 CAGTTAGAATGTTCTATATTGGG - Intronic
1031427992 7:121630999-121631021 TTTTCAGAATGTCAAATAGTTGG + Intergenic
1031639996 7:124150883-124150905 TTTCTAGAATGTCATATAGTTGG + Intergenic
1031946200 7:127843464-127843486 TTTCTAGAATGTCGTATAGTTGG + Intronic
1032015350 7:128376599-128376621 TTTCCAGAATGTCATATAGTTGG + Intergenic
1032577076 7:133066553-133066575 CTCTTAGAATGCCATCTTGTGGG - Intronic
1032620686 7:133527855-133527877 GTGTGAGAGTGTGATATAGTGGG + Intronic
1032757277 7:134903087-134903109 ATTTCAGAATGTCACATAGTTGG - Intronic
1032911782 7:136440574-136440596 TTTTCATAATGTCATATAGTTGG + Intergenic
1033039610 7:137905933-137905955 CTGTTACAATGTCTTACAGAAGG + Intronic
1033402669 7:141041793-141041815 TTTGCAGAATGTCATATAGTTGG - Intergenic
1033467346 7:141606882-141606904 TTTTTAAAATGTCATATAGTTGG + Intronic
1033826764 7:145200571-145200593 TTTCTAGAATGTCATAAAGTTGG + Intergenic
1035036926 7:155901651-155901673 CTGGTAGAATGTCACAAGGTTGG + Intergenic
1035053688 7:156019602-156019624 CTGGTAGAATGTGATACAATGGG - Intergenic
1035136961 7:156713163-156713185 TTCCCAGAATGTCATATAGTTGG - Intronic
1035188641 7:157145620-157145642 TTTCCAGAATGTCATATAGTTGG + Intronic
1035862912 8:3049504-3049526 TTACTAGAATGTCATATATTGGG - Intronic
1036503329 8:9333295-9333317 CTGGTAGAAGGTCATAGTGTTGG - Intergenic
1036812157 8:11874648-11874670 CTATTTGAATGTCACAGAGTTGG + Intergenic
1037017208 8:13923718-13923740 TTTTTAGAATGTCTTATAGTTGG + Intergenic
1037058620 8:14478454-14478476 TTCTTGGAATGTCATGTAGTTGG - Intronic
1037136565 8:15469915-15469937 TTTCTAGAATGTCATATAGTTGG - Intronic
1037148106 8:15598661-15598683 TTTTCAGAATGTCATAAAGTTGG + Intronic
1037192914 8:16148953-16148975 TTTCCAGAATGTCATATAGTTGG - Intronic
1037256002 8:16954550-16954572 CTTCCAGAATGTCATATTGTTGG - Intergenic
1037515827 8:19630696-19630718 TTTCCAGAATGTCATATAGTTGG + Intronic
1038013767 8:23496081-23496103 TTTCTGGAATGTCATATAGTTGG + Intergenic
1038031146 8:23641515-23641537 TTTTCAGAATGTCATATAATTGG + Intergenic
1038050809 8:23809032-23809054 TTGCCAGAATGTCATATAGTTGG + Intergenic
1038144044 8:24877506-24877528 TTTCCAGAATGTCATATAGTTGG - Intergenic
1038273154 8:26093581-26093603 TTTTCAGAATGTCATATAGTTGG - Intergenic
1038314815 8:26475145-26475167 TTTTTAGAATGTCATACAGTTGG + Intronic
1038324056 8:26558362-26558384 TTGCCAGAATGTCATAGAGTTGG - Intronic
1038460483 8:27712187-27712209 TTTTCAGAATGTCACATAGTTGG + Intergenic
1038604543 8:28986137-28986159 TTTCCAGAATGTCATATAGTTGG + Intronic
1038652321 8:29416717-29416739 TTTTTAGAATGTCATATAAATGG - Intergenic
1039544030 8:38394957-38394979 TTTCCAGAATGTCATATAGTTGG + Intronic
1039782826 8:40804005-40804027 TTTCTAGAATGTCATATAGTTGG - Intronic
1039925107 8:41922925-41922947 TTTTCAGAATGTCATATAATTGG - Intergenic
1040004810 8:42610937-42610959 TTTCCAGAATGTCATATAGTTGG - Intergenic
1040040596 8:42912969-42912991 TTTCTGGAATGTCATATAGTTGG + Intronic
1040690120 8:49927590-49927612 TTTCCAGAATGTCATATAGTTGG - Intronic
1040754477 8:50755324-50755346 TTTTCAAAATGTCATATAGTTGG + Intronic
1041299892 8:56399996-56400018 TTCCTAGAATGTCATATTGTTGG + Intergenic
1041555745 8:59153082-59153104 TTTTCAGAATGTCATATAGTTGG + Intergenic
1041685426 8:60640438-60640460 TTTCCAGAATGTCATATAGTTGG - Intergenic
1042152092 8:65799014-65799036 CTGTTAGAACTTCATATAAATGG - Intronic
1042154493 8:65828052-65828074 CTGTTAGAGTATCATATAAGTGG - Intronic
1042253795 8:66782696-66782718 TTTCTAGAATGTCATATAATTGG + Intronic
1042366689 8:67945391-67945413 TTTTCAGAATGTCATGTAGTTGG - Intergenic
1042660750 8:71151703-71151725 CTCCCAGAATGTCACATAGTTGG + Intergenic
1042677455 8:71337581-71337603 CTTTTAGAAAGTCTTATAGTAGG - Intronic
1042782575 8:72508440-72508462 AAGTTAAAATGTTATATAGTAGG - Intergenic
1043159950 8:76833950-76833972 TTTCCAGAATGTCATATAGTTGG + Intronic
1043172222 8:76979720-76979742 CTGTCAGAATGTCCTAAATTAGG - Intergenic
1043250185 8:78062700-78062722 TTTTCAGAATGTCATATAATTGG - Intergenic
1043494386 8:80783946-80783968 TTTCCAGAATGTCATATAGTTGG + Intronic
1043739676 8:83795090-83795112 TTTTCAGAATGCCATATAGTTGG - Intergenic
1043861805 8:85326310-85326332 CTGCCAGAATTTCATATATTTGG - Intergenic
1044002050 8:86894756-86894778 TTTTTAGAATGTCATATAGTTGG + Intronic
1044104236 8:88182978-88183000 TTTCTAGAATGTCATATAGTTGG - Intronic
1045053522 8:98349172-98349194 TTTCTAGAATGTCATATAGTTGG - Intergenic
1045130857 8:99150603-99150625 TTTCTAGACTGTCATATAGTTGG + Intronic
1045154659 8:99454077-99454099 TTTTAAGAATGTCATATAATTGG + Intronic
1045830911 8:106459076-106459098 CTGTTAGAAGGACATAAATTTGG + Intronic
1045850784 8:106696189-106696211 TTTTTAGAGTGTCATATAGTTGG + Intronic
1047050703 8:121108871-121108893 TTTCCAGAATGTCATATAGTTGG - Intergenic
1047137128 8:122092068-122092090 TTTCCAGAATGTCATATAGTTGG + Intergenic
1047464584 8:125099968-125099990 CTGGGAGAATGTCTTAGAGTAGG + Intronic
1047508934 8:125501638-125501660 CTGTGAGAATTTCAGATGGTTGG + Intergenic
1047660764 8:127033904-127033926 TTTCCAGAATGTCATATAGTTGG - Intergenic
1048188715 8:132268153-132268175 CTTCTAGAATGTCATATAGTTGG + Intronic
1048318613 8:133380884-133380906 TTTTCAGAATGCCATATAGTTGG - Intergenic
1048994191 8:139781423-139781445 TTTCTAGAATGTCATATAGTTGG - Intronic
1050601089 9:7252185-7252207 TTTTTAGAATGTCATATAGTTGG + Intergenic
1050838478 9:10114762-10114784 TTGCTAAAATGTCATATTGTAGG - Intronic
1051007629 9:12366635-12366657 TTTCTAGAATGTCATATTGTTGG - Intergenic
1052332910 9:27288778-27288800 TTTCTAGAATGTCATATAGTTGG - Intronic
1052520569 9:29543186-29543208 TTCTCAGAATGTCATATATTTGG + Intergenic
1052636613 9:31114792-31114814 TTTCTAGAATGTCATATAGTTGG - Intergenic
1052958638 9:34275062-34275084 CTGTTGTATTGTCAAATAGTAGG - Intronic
1055072800 9:72184422-72184444 TTTCCAGAATGTCATATAGTTGG + Intronic
1055324063 9:75110313-75110335 TTTCCAGAATGTCATATAGTTGG + Intronic
1055518694 9:77059196-77059218 TTGCCAAAATGTCATATAGTTGG + Intergenic
1055526976 9:77144796-77144818 TTTCCAGAATGTCATATAGTTGG - Intergenic
1055743432 9:79415436-79415458 TTTCCAGAATGTCATATAGTTGG - Intergenic
1055882396 9:81016425-81016447 TTCCTATAATGTCATATAGTTGG - Intergenic
1055972222 9:81923022-81923044 ATTTTCAAATGTCATATAGTTGG - Intergenic
1055973975 9:81938094-81938116 ATTTTCAAATGTCATATAGTTGG - Intergenic
1055997483 9:82176021-82176043 TTTTGAGAATGTCGTATAGTTGG + Intergenic
1056749045 9:89332537-89332559 TTTCTAGAATGTCATATAGTTGG + Intronic
1056857583 9:90147184-90147206 TTTCCAGAATGTCATATAGTTGG + Intergenic
1057598711 9:96438649-96438671 CTTCCAGAATGTCATAGAGTTGG - Intergenic
1059089733 9:111343092-111343114 TTTCTAGAATATCATATAGTTGG - Intergenic
1059090829 9:111356088-111356110 TTTCCAGAATGTCATATAGTTGG + Intergenic
1060111143 9:120907181-120907203 TTTCCAGAATGTCATATAGTTGG + Intronic
1060382344 9:123188086-123188108 TTTCAAGAATGTCATATAGTTGG + Intronic
1060385473 9:123223138-123223160 TTTCTGGAATGTCATATAGTTGG - Intronic
1060529743 9:124341286-124341308 CTGTTAAAATGAAATATAGCAGG - Intronic
1186695640 X:12028701-12028723 CTTCCACAATGTCATATAGTTGG + Intergenic
1186822148 X:13300375-13300397 ATTCCAGAATGTCATATAGTTGG + Intergenic
1187181866 X:16950102-16950124 TTTTTAGAATGTCATATAGTTGG + Intronic
1187631728 X:21180559-21180581 CTATTAAAATTTCATGTAGTGGG - Intergenic
1187643652 X:21322193-21322215 TTTCCAGAATGTCATATAGTGGG + Intergenic
1187736388 X:22308517-22308539 TTTCCAGAATGTCATATAGTTGG + Intergenic
1187800557 X:23057984-23058006 TTTCTAGAATGTGATATAGTTGG - Intergenic
1187911251 X:24113102-24113124 TTTCCAGAATGTCATATAGTTGG + Intergenic
1187949579 X:24458587-24458609 TTTCCAGAATGTCATATAGTTGG - Intergenic
1188165822 X:26862367-26862389 CTTCCAGATTGTCATATAGTTGG + Intergenic
1188329062 X:28846142-28846164 TTTCCAGAATGTCATATAGTTGG + Intronic
1188428659 X:30079331-30079353 TTTTCAGAATGTCATATAGTTGG + Intergenic
1188699499 X:33240737-33240759 CTGTTAGAATGACATCAAGAAGG - Intronic
1188839238 X:34994845-34994867 TTTCTGGAATGTCATATAGTTGG + Intergenic
1188883751 X:35523886-35523908 TTATCAGAATGTCATATAGCTGG + Intergenic
1189022639 X:37357130-37357152 TTTTCAAAATGTCATATAGTTGG + Intronic
1189353067 X:40291614-40291636 CTGTTGATATGTGATATAGTTGG - Intergenic
1189631681 X:42960918-42960940 CTGTCAAAATGTCATATTTTGGG - Intergenic
1189977000 X:46471694-46471716 TTTCTAGAATGTCATATAGTTGG + Intronic
1190011134 X:46786029-46786051 TTTCCAGAATGTCATATAGTTGG - Intergenic
1190139118 X:47825985-47826007 CTTATAGATTGGCATATAGTTGG - Intergenic
1190281389 X:48933105-48933127 TTTCTAGAATGTCATATAATTGG - Intronic
1190558441 X:51662503-51662525 TTTCCAGAATGTCATATAGTTGG - Intergenic
1190803141 X:53811463-53811485 TTTCTAGAATGTCATATAGTTGG - Intergenic
1190899970 X:54662111-54662133 TTTTCAGAACGTCATATAGTTGG + Intergenic
1191872201 X:65757082-65757104 TTTCTAGAATGTCATATAGTTGG + Intergenic
1192431499 X:71115379-71115401 TTTCCAGAATGTCATATAGTTGG - Intergenic
1192862612 X:75093341-75093363 TTTCCAGAATGTCATATAGTTGG - Intronic
1192903668 X:75525969-75525991 CTTCCAGAATGTCATATAGTTGG + Intergenic
1193172586 X:78353521-78353543 CTTTAAGACTGTCATTTAGTTGG + Intergenic
1194495002 X:94603783-94603805 CTTTCAAAATGTCATATAGTTGG - Intergenic
1194518536 X:94889808-94889830 TTTTAAGAATGTCAAATAGTTGG + Intergenic
1196000341 X:110777064-110777086 ATTCCAGAATGTCATATAGTTGG + Intronic
1196313348 X:114195491-114195513 TTTCCAGAATGTCATATAGTTGG - Intergenic
1196507726 X:116467894-116467916 TTTCCAGAATGTCATATAGTTGG + Intergenic
1197212230 X:123837605-123837627 CTTCCAGAATGTCACATAGTTGG + Intergenic
1197569719 X:128134015-128134037 TTTTTAGAATGCCATATAGTTGG - Intergenic
1197803243 X:130374216-130374238 TTTCCAGAATGTCATATAGTTGG + Intergenic
1198096318 X:133383346-133383368 TTTCCAGAATGTCATATAGTTGG - Intronic
1198842639 X:140875469-140875491 TTCCCAGAATGTCATATAGTGGG - Intergenic
1198874219 X:141205494-141205516 TTACCAGAATGTCATATAGTTGG - Intergenic
1199008662 X:142732271-142732293 CTGTTACAATGCCATTTAGGTGG + Intergenic
1199417842 X:147606711-147606733 TTTCCAGAATGTCATATAGTTGG + Intergenic
1199501561 X:148512664-148512686 CTGTTAAAATTACATAAAGTAGG + Intronic
1199823451 X:151474057-151474079 TTTCCAGAATGTCATATAGTTGG + Intergenic
1199864896 X:151835596-151835618 TTTCCAGAATGTCATATAGTTGG - Intergenic
1201157524 Y:11146303-11146325 CTCCCAGAATGTCATATAATAGG + Intergenic
1201623068 Y:15981455-15981477 CTGTTAGACTGGGATAGAGTTGG - Intergenic