ID: 977955787

View in Genome Browser
Species Human (GRCh38)
Location 4:103024072-103024094
Sequence GCTGCTAGGGAGCTCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977955787 Original CRISPR GCTGCTAGGGAGCTCATGGC AGG (reversed) Intronic
900182853 1:1320018-1320040 GCTGCTGGGGAGGACAGGGCAGG + Intronic
900479253 1:2890127-2890149 GGGGATGGGGAGCTCATGGCAGG + Intergenic
900577161 1:3389126-3389148 GCTGCAGAGGAGCACATGGCCGG - Intronic
901326493 1:8368951-8368973 GCTACTTGGGAGATCAAGGCAGG + Intronic
901856678 1:12048943-12048965 GCTTCTGGGGAGGTCAAGGCAGG - Intergenic
902031017 1:13422336-13422358 GCTGCTCGGGAGCACGAGGCAGG - Intergenic
902519250 1:17006657-17006679 GCTCCAAGGAAGCTAATGGCTGG - Intronic
902775494 1:18671863-18671885 GCTGCTTGGGAGGTCGAGGCAGG + Intronic
902801360 1:18832121-18832143 GCTGCTGGGAAGCTCAAAGCAGG - Intergenic
903805547 1:26002964-26002986 GCTACTAGGGAGGTTAAGGCAGG + Intergenic
904644200 1:31953910-31953932 GCTGCTAGGGAGGCTAAGGCAGG - Intergenic
905877644 1:41443118-41443140 GCTGCTCGGGAACTCAGAGCAGG - Intergenic
907041235 1:51262099-51262121 GCTACTAGGGAGGCCAAGGCGGG - Intronic
910199346 1:84682614-84682636 GCTACTCGGGAGGTCAAGGCAGG - Intronic
912403990 1:109421073-109421095 GCTGCTAGGGAGGTTAAGGTGGG + Intronic
913671647 1:121102323-121102345 GCTGCTAGGGAGGCCGAGGCAGG - Intergenic
914023422 1:143889763-143889785 GCTGCTAGGGAGGCCGAGGCAGG - Intergenic
914437177 1:147670410-147670432 GCCGCCAGGGAACTCAGGGCCGG - Exonic
914756104 1:150562358-150562380 GCCGAGAGGGAGCTCATGGGCGG - Intergenic
915726862 1:158024388-158024410 GCTACTAGGGAGGTCGAGGCAGG - Intronic
917874665 1:179275128-179275150 GCTACTAGGGAGGCCAAGGCAGG + Intergenic
918002282 1:180508888-180508910 GCTGCGCAGGAGCCCATGGCGGG - Intergenic
920389261 1:205588846-205588868 GCTTCCAGGGAGCTTACGGCCGG + Intronic
920397947 1:205660202-205660224 GGGACAAGGGAGCTCATGGCAGG - Intronic
922115721 1:222611840-222611862 GCTACTAGGGAGGTCGAGGCAGG - Intergenic
923195990 1:231667942-231667964 GCTACTTGGGAGGTCAAGGCTGG + Intronic
923726686 1:236511681-236511703 GCTACTAGGGAGGTTAAGGCAGG + Intergenic
924826476 1:247544741-247544763 GCTACTCGGGAGCCCAAGGCAGG + Intronic
1064237438 10:13588463-13588485 GCTGCTTGGGAGACCAAGGCGGG + Intronic
1066088753 10:31997018-31997040 GCTACTCGGGAGGTCAAGGCAGG - Intergenic
1066568733 10:36748600-36748622 GCTGCATGGGAGCCCATGGGGGG - Intergenic
1068029716 10:51691560-51691582 GCTGTTTGGGAGCCCAAGGCTGG - Intronic
1068725084 10:60291822-60291844 GCTACTAGGGAGGTCAAGGTGGG - Intronic
1068996807 10:63215397-63215419 GCAGCTTGGGAGTTCATTGCTGG + Exonic
1070099177 10:73368762-73368784 GCTGCTTGGGAGGCCAAGGCAGG - Intergenic
1070109129 10:73465338-73465360 GCTGCTAGGGAGGCTAAGGCAGG - Intronic
1070197500 10:74172575-74172597 GCTGCTAGGGAGGTTGAGGCAGG + Intronic
1070424839 10:76276249-76276271 GCTACTAGGGAGGCCAAGGCAGG - Intronic
1071926471 10:90415478-90415500 GCTGCTTTGGCACTCATGGCGGG + Intergenic
1072543959 10:96419905-96419927 ACTGCTAGGAAGCACAGGGCAGG + Intronic
1072971702 10:100022993-100023015 GCTACTAGGGAGGTTAAGGCAGG + Intergenic
1073246165 10:102091680-102091702 GCTGCTAGGGAGGCCGAGGCTGG + Intergenic
1073376356 10:103038722-103038744 CCTGCTAGGGAGGTCTGGGCCGG + Intronic
1074764806 10:116692553-116692575 GCTCCTGAAGAGCTCATGGCAGG - Intronic
1075758148 10:124832731-124832753 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1075836406 10:125457051-125457073 GCTGCTTGGGAGGCCAAGGCAGG + Intergenic
1076475685 10:130750081-130750103 GCAGGTGGGGAGCTCAGGGCAGG - Intergenic
1076733744 10:132450059-132450081 TCTGCTGGGGAGCTCATGAGTGG + Intergenic
1076982612 11:212887-212909 GCTGCCAGGGGCCTCATGGCAGG + Exonic
1077314423 11:1911328-1911350 GCTACTAGGGAGGCCAAGGCAGG + Intergenic
1077436130 11:2540057-2540079 GCTGCTAGGGAAGTCATTGGGGG + Intronic
1077487761 11:2846876-2846898 GCTGGCAGGGAGGTCAAGGCAGG - Intronic
1078087577 11:8243382-8243404 TCTGCCTGGGAGCCCATGGCTGG - Intronic
1079090635 11:17477495-17477517 GCTGCGAGGGAGCTGAAGGGAGG + Intergenic
1080648219 11:34202726-34202748 GCTACTAGGGAGGTAAAGGCAGG + Intronic
1081315234 11:41623119-41623141 GCTGCGTGGGAGCCCATGGTGGG - Intergenic
1081670357 11:44938999-44939021 GCTGGTGGGGGGCTGATGGCCGG - Intronic
1081919233 11:46757379-46757401 GCTGCTAGGGAGGCCGAGGCAGG + Intronic
1085001607 11:73042036-73042058 GCTACTTGGGAGGTCAAGGCAGG - Intronic
1086001549 11:81990894-81990916 GCTGAGAGGGAGCCCACGGCTGG + Intergenic
1086090331 11:82998822-82998844 GCAGTTAGGGAGCTCATGAGGGG + Intronic
1086128829 11:83379488-83379510 GCTGCCAGGGAGCTGAAAGCAGG + Intergenic
1087037217 11:93767594-93767616 GCTACTAGGGAGGTTAAGGCAGG + Intronic
1088479349 11:110280353-110280375 GCTACTTGGGAGCCCAAGGCAGG - Intronic
1090878498 11:130812814-130812836 CCTGCCAGGGTCCTCATGGCTGG + Intergenic
1091008248 11:131973703-131973725 GCTGCTCGGGAGGCCAAGGCAGG + Intronic
1091311275 11:134576923-134576945 GGAGCTTGGGAGCTCAGGGCAGG + Intergenic
1091435932 12:473078-473100 GCTACTAGGGAGGCCAAGGCAGG - Intronic
1092084139 12:5741888-5741910 CCAGCTAGGGATCCCATGGCAGG - Intronic
1093371141 12:18366419-18366441 GCTACTCGGGAGGTCAGGGCAGG + Intronic
1094637695 12:32242413-32242435 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1095996950 12:48095422-48095444 GCTACTAGGGAGGTTAAGGCAGG + Intronic
1096269860 12:50156290-50156312 GCTGCTGGGGAGGCCAAGGCAGG + Intronic
1096788867 12:54033117-54033139 GCTACGTAGGAGCTCATGGCGGG - Exonic
1096988801 12:55781420-55781442 GCTACTTGGGAGGTCAAGGCAGG + Intronic
1098233465 12:68396135-68396157 GCTACTAGGGAGGCCAAGGCAGG + Intergenic
1099925924 12:89017069-89017091 GCTGCTAGGGAGCCTGAGGCAGG - Intergenic
1100674226 12:96848583-96848605 GCTGCTTGGGAGGTTGTGGCAGG + Intronic
1100824611 12:98462940-98462962 GCTACTAGGGAGGCCAAGGCAGG + Intergenic
1101268539 12:103118101-103118123 GCTTCAAGGCAGCTCATGCCTGG + Intergenic
1101384655 12:104245999-104246021 GCTACTCGGGAGGTCAAGGCAGG + Intronic
1102875221 12:116443845-116443867 CCTGCTAGAGATCCCATGGCTGG - Intergenic
1103127831 12:118439711-118439733 GCTGCTTGGGAGGTTAAGGCAGG - Intergenic
1103496051 12:121363030-121363052 GCTTCTAGGGAGGTCGAGGCAGG - Intronic
1103497591 12:121374717-121374739 GCTGCCAAGGAGCTCAGGGCGGG - Intronic
1103588940 12:121976795-121976817 GCTGCTCAGGAGGCCATGGCAGG + Intronic
1103820844 12:123697609-123697631 GCTGCTAGGGAGGCTAAGGCAGG - Intronic
1104332461 12:127859875-127859897 GCTGCTTGGGAGGCCAAGGCAGG + Intergenic
1104946271 12:132416243-132416265 GCTGCTAGGGCGGTCCTGCCTGG - Intergenic
1105330496 13:19411255-19411277 GCTGCCATTGACCTCATGGCAGG + Intergenic
1105477354 13:20740006-20740028 GCTGCGCGGGAGCCCATGGTGGG + Intronic
1106083009 13:26516086-26516108 GCTGGTAGGAAGCTCATGATGGG - Intergenic
1106118801 13:26840264-26840286 GCTTGTAGGAAGCTCAGGGCTGG - Intergenic
1109110975 13:58318611-58318633 GCTGCGCAGGAGCCCATGGCAGG + Intergenic
1109447799 13:62466886-62466908 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1110146939 13:72203136-72203158 GTTGCGGGGGAGCTCTTGGCGGG - Intergenic
1110219925 13:73061072-73061094 GCTGCTAAGGAGCCCGTGGGTGG - Intronic
1112064718 13:95780994-95781016 TGTGCTGGGGAGCTCAGGGCAGG + Intronic
1113006155 13:105704765-105704787 GCTACTAGGGAGGCCAAGGCAGG - Intergenic
1115732188 14:36283178-36283200 ACTGTTAGGGAGATCATTGCTGG + Intergenic
1116457847 14:45139871-45139893 GCTGCTTGGGAGGCCAAGGCAGG + Intronic
1116851541 14:49914079-49914101 GCTGCTAGGGAGGTTGAGGCAGG - Intergenic
1117718678 14:58606810-58606832 GCTGCTGGGAAGTTCAGGGCAGG + Intergenic
1117720879 14:58627690-58627712 GCTACTGGGGAGCCCAAGGCAGG + Intergenic
1117821254 14:59651624-59651646 GCTGCTTGGGAGGTCGAGGCAGG + Intronic
1119159842 14:72443698-72443720 GCTGGGAGGGACCTGATGGCTGG - Intronic
1119494461 14:75066738-75066760 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1120270871 14:82311049-82311071 GCTGCTTGGGAGGTCAAGGCAGG + Intergenic
1120434723 14:84466637-84466659 GCTACTCGGGAGGTCAAGGCAGG + Intergenic
1121717193 14:96084730-96084752 ACTGCTATGGGGCTCAGGGCAGG - Intronic
1122177661 14:99933004-99933026 GCTACTCGGGAGACCATGGCAGG + Intronic
1122536769 14:102470417-102470439 GCTACTAGGGAGGCCAAGGCAGG - Intronic
1125330194 15:38574715-38574737 GGTGCTTGGGAGGGCATGGCTGG - Intergenic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125679336 15:41521021-41521043 GATGCTGGGGAGGTCCTGGCAGG + Exonic
1126232571 15:46344287-46344309 GCTGCTAGGCAGCTCATCTGGGG + Intergenic
1126768525 15:52032794-52032816 GCTGCTAGGGAGGTTGAGGCAGG - Intronic
1127103288 15:55588422-55588444 GGGGCTGGGGAGCTCAGGGCGGG - Intronic
1128983527 15:72202876-72202898 ACCGCCAGGGAGGTCATGGCAGG - Intronic
1130235671 15:82131401-82131423 GCTGCTTGGGAGGTCAAGGGAGG - Intronic
1130958303 15:88642726-88642748 GCTACTTGGGAGGTCAAGGCGGG - Intronic
1131379197 15:91949748-91949770 GCTACTTGGGAGGTCAAGGCAGG + Intronic
1132155806 15:99494753-99494775 GCTGCCCAGGAGCCCATGGCGGG + Intergenic
1132308753 15:100839498-100839520 GCTACTAGGGAGGCCAAGGCAGG + Intergenic
1132562605 16:604164-604186 GCTGCTAGGGAGCTGCTAGGTGG - Intronic
1133092927 16:3418687-3418709 GCTGCTTGGGAGGCCAAGGCAGG + Intronic
1133968119 16:10546526-10546548 TCTGCTGGGGAGGACATGGCCGG + Intronic
1135261625 16:20985766-20985788 GCTGGTAGGGACATCATGGAGGG + Intronic
1135418803 16:22290230-22290252 GCTACTAGGGAGGTCGAGGCGGG - Intergenic
1135586797 16:23678063-23678085 GCTGCTAGGGAGGCCGAGGCGGG + Intronic
1136338704 16:29628184-29628206 GCTGCTAGGGAGGCTAAGGCAGG - Intergenic
1139091238 16:63650587-63650609 GCTACTAGGGAGGCCAAGGCAGG + Intergenic
1139652422 16:68369103-68369125 GCTACTTGGGAGGCCATGGCAGG + Intronic
1141662881 16:85450960-85450982 GCTACTAGGGAGGCCAAGGCAGG + Intergenic
1142136261 16:88453282-88453304 ACTGCGAGGGCGCTCCTGGCGGG - Intergenic
1142547972 17:718756-718778 GCAGTTAGGGAGGTCAAGGCAGG - Intronic
1142723489 17:1793930-1793952 GCTACTAGGGAGGCCAAGGCAGG - Intronic
1142951366 17:3483772-3483794 GCTACTAGGGAGCTTGAGGCAGG - Intronic
1143039597 17:4023982-4024004 ACTGATAGGGAGGTCATGGAGGG - Intronic
1143191165 17:5041196-5041218 GCTGCTTGGGAGGTCAAAGCTGG - Intronic
1144572821 17:16410557-16410579 GCTACTTGGGAGGTCAAGGCAGG + Intergenic
1144610581 17:16710091-16710113 GCTACTAGGGAGCCTAAGGCAGG + Intronic
1144759271 17:17698252-17698274 GCTTCTGGGTGGCTCATGGCAGG + Intronic
1144902162 17:18605302-18605324 GCTACTAGGGAGCCTAAGGCAGG - Intergenic
1144928902 17:18840650-18840672 GCTACTAGGGAGCCTAAGGCAGG + Intronic
1145130338 17:20340775-20340797 GCTACTAGGGAGCCTAAGGCAGG + Intergenic
1146442377 17:32908308-32908330 GCTACTTGGGAGGTCAAGGCAGG - Intergenic
1146446399 17:32936230-32936252 GCTGCGATGGAACTCACGGCAGG + Intronic
1147411780 17:40258285-40258307 GCTGCTTGGGAGGCCAAGGCAGG + Intronic
1147426188 17:40346959-40346981 GCTGCTAGGCGGCTGATGACAGG - Intronic
1147691483 17:42318062-42318084 GCTGCTTGGGAGCCTAAGGCAGG - Intronic
1148032698 17:44632649-44632671 GCTGCTTGGGAGGTTAAGGCAGG + Intergenic
1150261145 17:63791933-63791955 GCTACTAGGGAGGGCAAGGCAGG + Intronic
1150350647 17:64442006-64442028 GCTACTTGGGAGACCATGGCAGG - Intergenic
1150683484 17:67301715-67301737 GCTGCTAGGGAGGCTAAGGCAGG + Intergenic
1152856446 17:82667448-82667470 GGTGCTCGGGATCTCATGGAAGG - Intronic
1154031155 18:10755699-10755721 GCTGCTAGGGAGCCCTTGCATGG + Intronic
1155405209 18:25480345-25480367 GCTACTAGGGAGGCCAAGGCGGG + Intergenic
1156243000 18:35271728-35271750 GCTGCGTGGGAGCCCATTGCGGG + Intronic
1156335692 18:36169496-36169518 GCTGCTAGGGAGGCTAAGGCAGG - Intronic
1158713138 18:59854837-59854859 GCTACTTGGGAGGTCAAGGCAGG - Intergenic
1160018275 18:75160534-75160556 GCTGTTCGGCAGCTCAAGGCAGG + Intergenic
1160241913 18:77131243-77131265 GCCGCCAGGGAGCTCAGTGCGGG + Intronic
1160838352 19:1135248-1135270 GCTGCTCAGGAGGCCATGGCAGG + Intronic
1161155422 19:2730149-2730171 GCTGGGTGGGAGCTCAGGGCTGG - Intronic
1161201428 19:3017247-3017269 GCTACTCGGGAGGTCAAGGCAGG - Intronic
1161214566 19:3087274-3087296 GCTGCTTGGGAGGTTGTGGCAGG + Intergenic
1161565918 19:5002598-5002620 GCTGCTTGGGAGGCCAAGGCAGG - Intronic
1162089201 19:8267689-8267711 GCTACTCAGGAGCTCAAGGCAGG + Intronic
1162290599 19:9777218-9777240 GCTACTTGGGAGGTCAAGGCAGG + Intronic
1162678589 19:12320609-12320631 GCTGCTTGGGAGGCCAAGGCAGG - Intronic
1164835801 19:31354374-31354396 GCTTTTAGGGAGCCCAGGGCTGG + Intergenic
1165791656 19:38496345-38496367 GGTGCTGGGGAGCTCAGGGGAGG + Intronic
1166077395 19:40421496-40421518 GCAGAGAGGGAGCTCAGGGCAGG - Intergenic
1166088356 19:40491908-40491930 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1166196427 19:41208868-41208890 GCTACTCGGGAGGTCAAGGCAGG - Intergenic
1166515244 19:43441632-43441654 GCTGCTAGGGAGGCCAAGGCAGG + Intergenic
1167071300 19:47223453-47223475 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1167775269 19:51550569-51550591 GCTACTAGGGAGGCCAAGGCAGG - Intergenic
1168022772 19:53621671-53621693 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1168047204 19:53802593-53802615 GCTACTAGGGAGGTCGAGGCAGG + Intronic
1168321042 19:55509745-55509767 GCTACTAGGGAGGCCAAGGCAGG + Intronic
926707880 2:15849491-15849513 GCTGCTAGGAAGGTCCTGGGAGG - Intergenic
927242840 2:20933544-20933566 GGTGCTAGGGAGTGCATGGCAGG - Intergenic
928486581 2:31738402-31738424 GTTGTTAGGGAGCTAATGCCAGG - Intergenic
929564078 2:42974038-42974060 GCTGCTAGGGAGCTCCCAGAGGG + Intergenic
930534352 2:52628960-52628982 GCTGCTCGGGAGGCCAAGGCAGG - Intergenic
930653811 2:53988856-53988878 GCTGCTAAGGAGCCTAAGGCAGG - Intronic
930723993 2:54665043-54665065 GCTGATATGGAGATCAGGGCAGG - Intronic
931443662 2:62308808-62308830 GCTGCTCGGGAGGCCAAGGCAGG - Intergenic
931644532 2:64409888-64409910 GCTGCTTGGGAGATAATTGCAGG + Intergenic
933543456 2:83678843-83678865 GCAGCTAGGGCTCTCAGGGCGGG - Intergenic
933941715 2:87250662-87250684 GCAGCTGGGGAGCTGATGACAGG + Intergenic
936338510 2:111610907-111610929 GCAGCTGGGGAGCTGATGACAGG - Intergenic
937262551 2:120595767-120595789 GCCTGTAGGGAGCTCATGGCTGG + Intergenic
937317136 2:120938836-120938858 GCTGGTGGGGAACTCAGGGCTGG - Intronic
938523344 2:132097084-132097106 GCTGCTAGGGAGGCTAAGGCAGG - Intergenic
939869089 2:147507195-147507217 GCTGCGCAGGAGCCCATGGCGGG - Intergenic
941024344 2:160441611-160441633 GCTACTAGGGAGGCTATGGCAGG + Intronic
942244944 2:173999263-173999285 GCTGCTGGGGAGCTTGTGGTCGG - Intergenic
942551026 2:177119366-177119388 GCTACTGGGGAGGTCAAGGCGGG + Intergenic
942793710 2:179791866-179791888 GCTGCTAGGGAGGCTAAGGCAGG - Intronic
944666608 2:201964217-201964239 GCAGCTGGGGAGCCCATGGATGG - Intergenic
946301750 2:218828241-218828263 GGTGCTAGGGAGCAAATGGGGGG - Intronic
947171950 2:227320908-227320930 GCTGTGAGGGAGCCCATGGTGGG - Intergenic
947466110 2:230347881-230347903 TCTGCTAGGGTGCTGATGGCAGG + Intronic
948070059 2:235113896-235113918 GCGGCTAGTGAACACATGGCAGG - Intergenic
1171988247 20:31675770-31675792 ACTGCTAGGGAGGTCAAGGCAGG - Intronic
1172364000 20:34334959-34334981 GCTGCTACTGAACTCAGGGCAGG - Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174568676 20:51485406-51485428 GTTGGTAGGGAGCCCGTGGCTGG - Intronic
1175466291 20:59192790-59192812 GCTGCGCGGGAGGCCATGGCCGG + Exonic
1176160910 20:63648178-63648200 GCTGCTGTGGAACACATGGCTGG - Intronic
1176160954 20:63648369-63648391 GCTGATAGGGAGCTGGTTGCTGG - Intronic
1176193493 20:63825287-63825309 GCTTCTAGGGAGGCCAAGGCAGG + Intronic
1177669610 21:24208742-24208764 GCCGCGAGGGAGCCCACGGCGGG + Intergenic
1177894876 21:26845944-26845966 GCGGCTAAGGAGCTCCTGGCAGG - Intergenic
1178169269 21:30020517-30020539 GCAGAAAGGGAGCTCATGGATGG + Intergenic
1178624721 21:34205035-34205057 GCTGAAAGGGAGCCCAGGGCCGG - Intergenic
1180031257 21:45210019-45210041 GCTCCCCGGGAGCTCATGCCTGG + Intronic
1180564393 22:16650586-16650608 GCTGCCATTGACCTCATGGCAGG - Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1182493982 22:30693851-30693873 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1183434129 22:37783484-37783506 GCCACAAGGGAGCTCATGGCGGG - Intergenic
1184250566 22:43257947-43257969 GCTGCTAGGGAGCCCACGTCAGG + Intronic
1184403572 22:44287412-44287434 GGTGCCTGGGAGCTCCTGGCTGG + Intronic
1185067687 22:48640279-48640301 GCTGCGTGGGAGCTCAGAGCTGG + Intronic
1185201491 22:49508511-49508533 GCTACTAGGGAGGTCGAGGCAGG - Intronic
949968512 3:9381041-9381063 GCTACTAGGGAGGCCAAGGCAGG - Intronic
951120982 3:18928444-18928466 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
953268926 3:41420592-41420614 GCTGCTCGGGAGGCCAAGGCAGG - Intronic
953874594 3:46659396-46659418 GCTGCTAGGCAGCTGTTGCCTGG + Intergenic
954058140 3:48045144-48045166 GCTGCTAGGGAGCCTGAGGCAGG + Intronic
954555586 3:51515337-51515359 GCTGCTCGGGAGGCCAAGGCAGG - Intergenic
955316108 3:57940496-57940518 GCTGCTCGGGAGGCCAAGGCAGG + Intergenic
955373327 3:58372736-58372758 GCTACTCGGGAGGTTATGGCAGG - Intronic
956632636 3:71331382-71331404 GCTGCGCAGGAGCCCATGGCGGG - Intronic
957215802 3:77317835-77317857 GCTGCTAGGGGGCTGCTGGGGGG + Intronic
961628614 3:128280613-128280635 GGTGCCAGGGAGCTCCTGGAGGG - Intronic
961883530 3:130080399-130080421 GCTACTCGGGAGGCCATGGCAGG - Intergenic
962752856 3:138446777-138446799 GCTACTAGGGAGGCCAAGGCAGG + Intronic
963056381 3:141189508-141189530 GCTACTTGGGAGGTCAAGGCAGG - Intergenic
963142899 3:141962468-141962490 GCTACTAGGGAGGCCAAGGCAGG - Intronic
963940681 3:151093190-151093212 GCTACTAGGGAGGTCAAGGTAGG + Intronic
965055617 3:163710480-163710502 GCTGCTAGGGAGGCTAAGGCAGG - Intergenic
965534204 3:169808200-169808222 GCTGCTCGGGAGGCCAAGGCAGG + Intronic
965539151 3:169855042-169855064 GCTGCTAGGGAGACCAAGGCAGG + Intronic
966345378 3:178973489-178973511 GATGGTAGGGAGCTCATTACTGG - Intergenic
967393032 3:188975799-188975821 GCTGCTTTGGTGCTCATGGGTGG - Intronic
969044194 4:4324700-4324722 GCTGGTAGGCAGCTCAGGACAGG - Intergenic
969453877 4:7290118-7290140 GCTGGCAGGAAGCTGATGGCTGG + Intronic
970549524 4:17165341-17165363 GTTGGGAGGGAGCACATGGCCGG - Intergenic
971303403 4:25460631-25460653 GCTACTTGGGAGGCCATGGCAGG + Intergenic
974026585 4:56738322-56738344 AGTGCTAGGGAGATGATGGCAGG + Intergenic
974028178 4:56752411-56752433 GCTACTCGGGAGCCCAAGGCAGG - Intergenic
974258724 4:59496537-59496559 GCTGCTTGGGAGGCCAAGGCAGG + Intergenic
974625162 4:64416828-64416850 GCTGCTCGGGAGGTTACGGCAGG - Intergenic
974929543 4:68346301-68346323 GCTACTAGGGAGCCCTTGGGAGG + Intronic
977179553 4:93857251-93857273 GCTGCTCGGAGGCTCATGGGGGG - Intergenic
977955787 4:103024072-103024094 GCTGCTAGGGAGCTCATGGCAGG - Intronic
978533121 4:109733921-109733943 GCACCTAGGGAGATCAAGGCTGG + Intergenic
982037460 4:151360158-151360180 ACTGAAAGTGAGCTCATGGCAGG + Intergenic
982187783 4:152819863-152819885 TCTCCTAGGGAGCTCATTGCGGG + Intronic
983230620 4:165126014-165126036 GCTGCACAGGAGCCCATGGCTGG + Intronic
983969344 4:173851812-173851834 GCTACTCGGGAGCCCAAGGCTGG + Intergenic
984574156 4:181427924-181427946 GCTGCTCGGGAGGCCAAGGCAGG + Intergenic
985559953 5:580034-580056 GCTGTTAGGGAGCTCCAGACAGG - Intergenic
985896763 5:2753384-2753406 TCGGCTCGGGAGCTCCTGGCGGG - Intronic
985936695 5:3102957-3102979 CCCACTCGGGAGCTCATGGCTGG - Intergenic
987012299 5:13779941-13779963 GCTCCTAGGGAGGACATGTCAGG - Intronic
989053977 5:37348190-37348212 GCTACTAGGGAGCCTGTGGCAGG + Intronic
990243281 5:53837214-53837236 GCTGCACAGGAGCCCATGGCAGG - Intergenic
990405707 5:55488532-55488554 GCTACTCGGGAGGTCAAGGCAGG + Intronic
992297815 5:75343508-75343530 GCTACTCGGGAGGCCATGGCAGG + Intronic
992884091 5:81140547-81140569 GCAGCTAGAATGCTCATGGCAGG + Intronic
994505751 5:100641385-100641407 GCTGCTTTGGCGCTCATGTCAGG + Intergenic
995839878 5:116433602-116433624 ACTGCCAGGGAGCTCAGGGAAGG + Intergenic
997946572 5:138208071-138208093 GCTGCTAGGGAGGCCGAGGCAGG - Intronic
999168991 5:149576842-149576864 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1000212390 5:159119414-159119436 GCTGCGCAGGAGCCCATGGCAGG - Intergenic
1000336485 5:160245248-160245270 GCTGCTGGGGAGCCGAAGGCAGG + Intergenic
1001818530 5:174691502-174691524 CCTGGTAGAGAGCTCAAGGCAGG - Intergenic
1003851475 6:10227133-10227155 GCTACTAGGGAGACCAAGGCAGG + Intergenic
1004056635 6:12145571-12145593 TCTGCTAGAGAGCTGAAGGCAGG - Intronic
1004354922 6:14922550-14922572 CCTGCTAATGAGCTCCTGGCCGG + Intergenic
1007049321 6:38810478-38810500 GCTGCTAGGGAGGCTGTGGCAGG + Intronic
1007619477 6:43203325-43203347 AGTTCTAGGGAGCTCAGGGCAGG + Intronic
1007811670 6:44490713-44490735 GCTGGTAGGTAGCTGAAGGCAGG + Intergenic
1008413920 6:51217282-51217304 GCTTACAGGGAGGTCATGGCTGG - Intergenic
1009504759 6:64463056-64463078 GCTGCTTGGGAGGCCTTGGCAGG - Intronic
1015338987 6:132075828-132075850 GCAGCTAGTGTGCTCATGGCAGG + Intergenic
1015773702 6:136792912-136792934 GCTGCTAGGAAGCTCGAGCCCGG + Intergenic
1016547736 6:145243290-145243312 GCTGCTAGGGAGGCTAAGGCAGG - Intergenic
1017345913 6:153380726-153380748 GCTGCTAGGGAGGCCGAGGCAGG - Intergenic
1018204454 6:161424223-161424245 GCTACTTGGGAGGCCATGGCAGG + Intronic
1019314267 7:377280-377302 TCTGCTGGGGAGGGCATGGCAGG + Intergenic
1019333980 7:474033-474055 GCTGCTAGGGAGGTAGAGGCAGG + Intergenic
1019553129 7:1613648-1613670 GCTGCTAGGGAGGCCCAGGCAGG + Intergenic
1019600896 7:1883284-1883306 GGTGTTAAGGAGCTCATGGTGGG - Intronic
1019618312 7:1977186-1977208 GCTGCGTGGGAGCCCACGGCTGG + Intronic
1019647001 7:2136306-2136328 TCTGCTTGTGAGCTCAGGGCTGG - Intronic
1022360966 7:29656953-29656975 GCTGCTAGGGAGGTTGAGGCAGG - Intergenic
1022963845 7:35455006-35455028 GGTGCCAGGGAGCTCGTGGGAGG - Intergenic
1022982860 7:35620764-35620786 GCTACTCAGGAGCCCATGGCAGG + Intergenic
1024680857 7:51685913-51685935 CCTGCTAGGGAATCCATGGCAGG - Intergenic
1025185666 7:56856357-56856379 GCTCCTAGGGAGGCCAAGGCAGG - Intergenic
1025267048 7:57471168-57471190 GCACTTTGGGAGCTCATGGCAGG + Exonic
1025686263 7:63720589-63720611 GCTCCTAGGGAGGCCAAGGCAGG + Intergenic
1026045292 7:66902555-66902577 GCCGCCAGGGAGCTGAAGGCAGG - Intergenic
1026281794 7:68928641-68928663 GCTGCTCGGGAGGGCAAGGCAGG + Intergenic
1026904529 7:74055327-74055349 GCTACTTGGGAGGTCAAGGCAGG + Intronic
1026940066 7:74282673-74282695 GCTGCTAGGGAGGCTAAGGCAGG - Intergenic
1027595197 7:80164471-80164493 GCTACTAGGGAGGCTATGGCAGG - Intronic
1028895858 7:96040831-96040853 GCTGCTAGGGAGGTTGAGGCAGG - Intronic
1029116342 7:98239441-98239463 GCTACTTGGGAGGCCATGGCAGG + Intronic
1030787558 7:113681470-113681492 GCTGCTTGGGAGGCCAAGGCAGG - Intergenic
1031720163 7:125164657-125164679 CATGCGAGGGAGATCATGGCAGG + Intergenic
1032487140 7:132296517-132296539 GCTGCTCGGGAGGCCAAGGCAGG - Intronic
1033227670 7:139574070-139574092 GCTTCTCGGGAGCCCAAGGCGGG - Intronic
1034694780 7:153043764-153043786 TCTGCAAGGGAGCTCAGGGCAGG - Intergenic
1035219611 7:157398186-157398208 ACTCCTAGGGAGCTCAAGGGTGG - Intronic
1036206648 8:6810438-6810460 GCTGGAAGGGAACTCTTGGCTGG + Exonic
1036448619 8:8845550-8845572 CCTGCTGGGGGGCCCATGGCAGG + Intronic
1036473095 8:9068446-9068468 GCTACTAGGGAGGCCAAGGCAGG - Intronic
1037291823 8:17359003-17359025 GCTGCTTGGGAGGTCGAGGCTGG - Intronic
1037461238 8:19111871-19111893 GCTACTAGGGAGCCTAAGGCAGG - Intergenic
1038778339 8:30550572-30550594 GCTGCTAGAGACCTCACGGCTGG + Intronic
1039061985 8:33579340-33579362 GCTACTAGGGAGGCCGTGGCAGG - Intergenic
1039788300 8:40853442-40853464 GCTGCTCAGGAGGTTATGGCAGG + Intronic
1040889990 8:52307070-52307092 GCTACTTGGGAGGTCAAGGCAGG + Intronic
1041256423 8:55983089-55983111 GCTGCTAGGCATCTCAGTGCAGG - Intronic
1041991641 8:63999622-63999644 GCTTCTAGGGGGCTCCTGCCTGG - Intergenic
1043282391 8:78484331-78484353 GCTACTCGGGAGCTCGAGGCAGG + Intergenic
1043760228 8:84059090-84059112 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1046931151 8:119843198-119843220 GCTGCTAGGGAGCCCGAGGCAGG - Intronic
1047036980 8:120950764-120950786 GCTGCTTGGGAGGCCAAGGCAGG - Intergenic
1047124794 8:121948365-121948387 GCTGCACAGGAGCCCATGGCGGG - Intergenic
1047743862 8:127829163-127829185 GCTACTAGGGAGGTCGAGGCAGG + Intergenic
1047956210 8:129978018-129978040 GCTACTCGGGAGCTTAAGGCAGG - Intronic
1049758685 8:144322108-144322130 GCTGGTTGGGAGATCATGGGTGG - Intronic
1050147355 9:2583469-2583491 GCTGCTATGGAGGGCATGGTGGG + Intergenic
1050580883 9:7055064-7055086 GCTGCTCGGGAGCCTATCGCAGG + Intronic
1051154098 9:14121150-14121172 GCTACTTGGGAGCTTAAGGCAGG + Intronic
1057216137 9:93229946-93229968 GCTGCTGGGGTGGTCCTGGCTGG + Intronic
1057725357 9:97564512-97564534 GCTGCATGGGATCTCAAGGCTGG + Intronic
1059268762 9:113059938-113059960 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059269898 9:113065387-113065409 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059271032 9:113070835-113070857 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059272165 9:113076281-113076303 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059273300 9:113081723-113081745 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059274436 9:113087169-113087191 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1060004944 9:119991751-119991773 TCTGCTGGGGAGCTCCTGGCTGG - Intergenic
1060438678 9:123618186-123618208 GCAGCAAGTGACCTCATGGCAGG - Intronic
1060913394 9:127369011-127369033 GCTGCTGGGAAGCTGAAGGCAGG - Intronic
1061600525 9:131667099-131667121 GCTACTAGGGAGGCCAAGGCAGG - Intronic
1061904032 9:133687380-133687402 GCTACTTGGGAGCCCAAGGCTGG - Intronic
1062162993 9:135089983-135090005 CCTGTTAGGGGGCTCAGGGCTGG - Intronic
1186385406 X:9105557-9105579 GCTGCTCGGGAGGCCAAGGCAGG + Intronic
1186596524 X:10987506-10987528 GCTGCTTGGGAGGCCAAGGCAGG - Intergenic
1187193447 X:17058339-17058361 GCTACTAGGGAGGCCAAGGCAGG + Intronic
1187710981 X:22054244-22054266 GCTACTAGGGAGGCCAAGGCAGG - Intronic
1190009956 X:46775943-46775965 GCTGCTAGGGACCCTAAGGCAGG - Intergenic
1190311870 X:49122621-49122643 GCTGTGAAGGAGCTCATTGCGGG - Exonic
1190448730 X:50556941-50556963 GCTGCTCGGGAGGCCAAGGCAGG - Intergenic
1193271101 X:79530868-79530890 GCTGCGCAGGAGCCCATGGCGGG - Intergenic
1194626719 X:96233989-96234011 GCAGCCAGCTAGCTCATGGCAGG + Intergenic
1195702711 X:107716819-107716841 GCTGCTAGGAAGCTCTGGCCGGG + Intronic
1197152847 X:123238905-123238927 CCTGCTAGGGAACTCATAACTGG - Intronic
1197721812 X:129750460-129750482 GCTTCTAGGGAGCACTTGGCAGG + Exonic
1199323426 X:146468375-146468397 GCTGCTAGGGAGATTAAGGCGGG + Intergenic
1199357871 X:146882357-146882379 GCTACTTGGGAGATCAAGGCAGG + Intergenic
1202600824 Y:26591555-26591577 GCTGCCATTGACCTCATGGCAGG - Intergenic