ID: 977956819

View in Genome Browser
Species Human (GRCh38)
Location 4:103037334-103037356
Sequence CAATTTTACCATAGGCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 2, 2: 9, 3: 22, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977956819 Original CRISPR CAATTTTACCATAGGCCAAT TGG (reversed) Intronic
901928185 1:12580233-12580255 GGATTTTCCCAGAGGCCAATGGG + Intronic
902511225 1:16967974-16967996 CAGTTTTAGCCCAGGCCAATGGG - Intronic
903143232 1:21352786-21352808 TAATTCTACAATAGCCCAATGGG + Intergenic
904355717 1:29938028-29938050 CAATTGTACCATAAGACAGTTGG - Intergenic
906697694 1:47835209-47835231 AAATTTGAAGATAGGCCAATTGG + Intronic
907337278 1:53708336-53708358 CAGTTTTCTCATAGGCCAAGTGG + Intronic
907708732 1:56856500-56856522 CAAATTTATAATATGCCAATTGG + Intronic
909235406 1:73147060-73147082 CAATTTTTCCACAGACCAAGGGG - Intergenic
909442496 1:75713536-75713558 CAATTATATCATATGCCCATGGG + Intergenic
910059939 1:83078402-83078424 CAATATTACCATCTGTCAATTGG + Intergenic
911246167 1:95520286-95520308 CAATTTTCCCCTAGACCTATAGG - Intergenic
911536143 1:99103158-99103180 CTATTTTACTATAAGACAATAGG - Intergenic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
919174136 1:193998625-193998647 CATATTTACCATAAGCTAATAGG + Intergenic
919356326 1:196527114-196527136 CAGTTTTCCCATAGACCAGTGGG - Intronic
920422368 1:205843833-205843855 GAATTCTCCCATAGGCCCATAGG + Intronic
921123520 1:212157241-212157263 CAATTTTACCATAGGCTAATGGG - Intergenic
922156154 1:223041118-223041140 CAATTCTACCAGTAGCCAATGGG - Intergenic
923949714 1:238935516-238935538 CAATTTTTCCATATGCTCATGGG - Intergenic
1066935543 10:41827865-41827887 CTATTTCACCATAGGCCATAAGG + Intergenic
1067982451 10:51101847-51101869 CAATTTTACCCCAGGCCCAGGGG - Intronic
1068864670 10:61882436-61882458 CAATTTTATCCTTGGCCACTTGG + Intergenic
1072525330 10:96266317-96266339 CAATTGTATCATAGTCCATTTGG + Intronic
1073809777 10:107139902-107139924 CAATTTCACCAAAGGCAAAACGG - Intronic
1078646689 11:13147315-13147337 CAATTTTAAGTTAGGCCTATGGG - Intergenic
1079309653 11:19353544-19353566 CATTTTCAACATAGGACAATGGG + Intronic
1079551514 11:21704665-21704687 CAATTTTACTATAGGCTTTTTGG + Intergenic
1081529518 11:43948279-43948301 CTATTTTTCCAGAGGCCAAAGGG - Intergenic
1081764173 11:45597912-45597934 CATTTTTCCCATCGGCAAATTGG + Intergenic
1082740796 11:56908818-56908840 CAATTTTCCCATGGACCAGTGGG + Intergenic
1085190731 11:74619555-74619577 CAGTTTTACCATATGCGAAAGGG - Intronic
1085213482 11:74804720-74804742 CAGTTTTACCACAGGCTAACTGG - Intronic
1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG + Intronic
1087154877 11:94891809-94891831 CAATTTCATCATAGACCCATTGG + Intergenic
1087267515 11:96076952-96076974 CAATTTTACAATAGCAAAATTGG + Intronic
1087417019 11:97870301-97870323 CACTTTTACTAAAGGACAATAGG - Intergenic
1087990388 11:104741374-104741396 AAGTTTCACCAGAGGCCAATGGG - Intergenic
1088451739 11:109988637-109988659 CAAATTTAACATAGCCCAATAGG - Intergenic
1089215398 11:116831743-116831765 CAATTTTTCCATGGGCCAGCGGG + Intronic
1090737195 11:129620217-129620239 CAATTTTAGCATTGGCCTTTTGG - Intergenic
1092038651 12:5363661-5363683 CAATTTTAGCCTAGGCCTACTGG - Intergenic
1092970837 12:13693203-13693225 CAATTTGACCATCAGCTAATTGG - Intronic
1097507182 12:60488731-60488753 TCATTTTCCCATAGGGCAATTGG - Intergenic
1098248475 12:68544516-68544538 CAATTGTACTTTAGTCCAATTGG + Intergenic
1099014516 12:77328232-77328254 CACTTTTATCACAGGCTAATTGG + Intergenic
1101182486 12:102234472-102234494 CAATTTTTCCATGGTCCAGTGGG - Intergenic
1106062706 13:26310373-26310395 CAATTTTTCCATGGACCAATGGG + Intronic
1106130269 13:26933847-26933869 CATTTTTGCCATAGCCCAAATGG + Intergenic
1106891590 13:34252108-34252130 CAATTTGGACATAGGCCATTAGG + Intergenic
1107569819 13:41644874-41644896 CAGTTTTACCATAGGCTAATTGG - Intronic
1109187545 13:59288620-59288642 CAATTTTAACATATTCCTATAGG - Intergenic
1109690259 13:65879004-65879026 CTATTTTACCATAAGCCAATTGG + Intergenic
1109790007 13:67233514-67233536 CAATTTTACTATAGCTCAAATGG - Intergenic
1110304594 13:73970591-73970613 CAGTTCTACCATATGCCAACTGG + Intronic
1110546395 13:76760649-76760671 CAATTTTAGACTAGGCCAGTAGG - Intergenic
1111200001 13:84923066-84923088 CATTTTTAACACAGGTCAATAGG - Intergenic
1112953334 13:105029800-105029822 CAATTTCACCATCTGCCAAATGG + Intergenic
1113967245 13:114160945-114160967 GAATTTTACCAAAGGCCTTTTGG + Intergenic
1114112824 14:19488615-19488637 CACTTTTCCCAGAGGCCACTAGG + Intergenic
1114889436 14:26898975-26898997 CTATTTTATCATAGGCGAAAGGG + Intergenic
1116143205 14:41027942-41027964 CAATTTAACCACAGGCTAAAGGG - Intergenic
1118011533 14:61615100-61615122 CAATTTTTCCATAGACCATGGGG - Intronic
1120170288 14:81242126-81242148 AAACTGTACCATAGGCCAAATGG - Intergenic
1126364954 15:47884612-47884634 CGATTGTACCATAGTACAATAGG + Intergenic
1128566207 15:68701811-68701833 CTATTTTACAATAGGGCAACTGG - Intronic
1130625921 15:85514680-85514702 CAACTTTTCCATAGGCTAAAAGG - Intronic
1130755447 15:86758095-86758117 AGATTTTACCATAGGAGAATTGG - Intronic
1131380269 15:91957675-91957697 CAACTTTACATAAGGCCAATAGG - Intronic
1138072286 16:54004680-54004702 GAATTTTCCCATAGGCCAAAGGG + Intronic
1138414879 16:56865930-56865952 CACTTTTCCCATATGACAATTGG + Intronic
1138601033 16:58054534-58054556 CAATTTTACCGTAGGTTAATTGG + Intergenic
1140950988 16:79817208-79817230 CAATCTGACCATAAGCCATTTGG + Intergenic
1143720011 17:8802884-8802906 CAATTTTCCCCTAGGCCACAGGG + Exonic
1146335693 17:31968193-31968215 CATTTTGACAATTGGCCAATTGG - Intronic
1147475762 17:40710193-40710215 CAATTTTTCCATAGACCAGGTGG - Intergenic
1147487814 17:40834920-40834942 CATTCTTACCAGAGGCCATTGGG + Exonic
1155978283 18:32155267-32155289 CAATTTTACCATAGGCTAATTGG - Intronic
1161717787 19:5886568-5886590 CAGTTTCCCCATAGGCCAAATGG + Intronic
1164347797 19:27287666-27287688 CTATTTTACCATAGGCCTCAAGG - Intergenic
925991868 2:9260698-9260720 CCATTCTACCATAGGGGAATGGG + Intronic
926544265 2:14219635-14219657 AAATTTTTCCATTGGACAATTGG - Intergenic
926937100 2:18096911-18096933 CATTGTTACCATAGCCTAATGGG - Intronic
927261741 2:21098464-21098486 CAGGTGTTCCATAGGCCAATTGG - Intergenic
928884873 2:36136745-36136767 CAATTTTACCAATGGCAAGTTGG + Intergenic
928896860 2:36275758-36275780 TAATTTTACCATAAGTTAATTGG - Intergenic
929902716 2:46019649-46019671 CAGTTTTACCATAGGCTAATTGG - Intronic
930608811 2:53518921-53518943 CAGTTTTCCCATATGCAAATGGG - Intergenic
931597866 2:63969705-63969727 CAATTTTTCCATAGACCAAGGGG - Intronic
933151648 2:78922436-78922458 CAATTTTACCATGGGCTAACTGG - Intergenic
934576880 2:95407787-95407809 CAATTTTTTAAAAGGCCAATTGG - Intronic
934863033 2:97780276-97780298 CAATTTTACCATCAATCAATCGG + Intronic
935414818 2:102804167-102804189 CAATTTTTCCATAGGTTATTGGG + Intronic
937582920 2:123511225-123511247 CAATTTTTCCATAGACTAATTGG + Intergenic
939619579 2:144402014-144402036 CAGTTTTATCACAGGCCAGTAGG + Intronic
939802603 2:146729255-146729277 GAATTTTACAATAGGAAAATCGG + Intergenic
940986769 2:160058817-160058839 CAAATTTTCCACAGGCCAATGGG + Intronic
941492931 2:166164791-166164813 TAAAATTGCCATAGGCCAATAGG - Intergenic
941691234 2:168502708-168502730 CCATTTTATCATTGGCCAGTAGG + Intronic
946440015 2:219687142-219687164 GAATTTTTCCAAAGGCTAATGGG - Intergenic
948650166 2:239438320-239438342 CAATTTTACTATATGCTATTTGG + Intergenic
1169882497 20:10362426-10362448 CAGTTTAACCAGATGCCAATGGG - Intergenic
1170253006 20:14306572-14306594 AAATTTTAACATAAGGCAATTGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1176318742 21:5284275-5284297 CTTTTTTACCATAGGCCACAAGG + Intergenic
1176476718 21:7223612-7223634 CTTTTTTACCATAGGCCACAAGG + Intergenic
1176872124 21:14092442-14092464 CCATTTTACAAAGGGCCAATTGG + Intergenic
1178332578 21:31712059-31712081 CAATTTTACCTTAGGGCATGAGG + Intronic
1181093397 22:20489624-20489646 CAATTTTAGAATACCCCAATGGG - Intronic
1184322060 22:43749437-43749459 CAATTTTTCCATGGGCCAGTGGG + Intronic
1185007859 22:48294630-48294652 CAATTCTACCACAGGAGAATTGG - Intergenic
950938758 3:16872296-16872318 CATTTTTACCACAGGCTGATTGG + Intronic
951281128 3:20750942-20750964 CCATTTTACCATTGTTCAATTGG - Intergenic
952327079 3:32330688-32330710 CCATTTTTCCATAGACCATTTGG - Intronic
954513134 3:51145798-51145820 CAATTTTTCCATAGACTGATGGG + Intronic
957292134 3:78291718-78291740 CAATTTTCCCATAGGTTAATTGG + Intergenic
958766481 3:98374004-98374026 ATATTTTTCCAGAGGCCAATAGG + Intergenic
963833821 3:150036221-150036243 TAATTTTAGCATAGGCAAACAGG - Intronic
964085821 3:152817033-152817055 AAATTTTTCCATAGGCATATTGG - Intergenic
965033778 3:163407862-163407884 CAATTATAAAATAGGCCACTTGG + Intergenic
965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG + Intergenic
967258966 3:187623238-187623260 CAATTTTCCTTTAGGCCAATAGG - Intergenic
969504579 4:7576892-7576914 CAATTTTACCATCTGGAAATGGG + Intronic
970676568 4:18457029-18457051 TAATTTTACCATAGGCTAATTGG - Intergenic
973777847 4:54259650-54259672 CAATTCTACCATATCCAAATGGG - Intronic
973849692 4:54948736-54948758 AAATTTGACCAAAGGCAAATAGG + Intergenic
976231882 4:82852840-82852862 CAATTTTTCCACAGGCCAGCAGG + Intronic
976845424 4:89483625-89483647 CAATTTTTCCACAGGCCAGCAGG - Intergenic
977001633 4:91511913-91511935 CAATTTTTCCACAGACCACTGGG - Intronic
977452172 4:97212561-97212583 CAGTTTTACCACAGGCTAATTGG - Intronic
977956819 4:103037334-103037356 CAATTTTACCATAGGCCAATTGG - Intronic
979790602 4:124776528-124776550 CAATTTTATCATAGGCTAATTGG + Intergenic
980247241 4:130263385-130263407 CAATTTTGCCATCTGCAAATAGG + Intergenic
981178083 4:141705588-141705610 AAATTATACCATAGACCAAATGG - Intronic
981564350 4:146082585-146082607 TAATTTTAACATAGGTCATTTGG + Intergenic
981759067 4:148173656-148173678 CAAATTTACCATAAGCTTATTGG - Intronic
983070482 4:163262024-163262046 CAACTTTACAATAGGCAAAAGGG - Intergenic
986826287 5:11526353-11526375 CAATTTCACCATAGGCGAGTTGG - Intronic
986873877 5:12081937-12081959 CAATTGTACCCTAGGCCAATGGG + Intergenic
990413907 5:55567759-55567781 TAATTTTTCCATAGGTTAATGGG + Intergenic
994896185 5:105706431-105706453 CTAATTTACCATAGGCTAATTGG - Intergenic
994934145 5:106231547-106231569 TAATTTTACCATAGGAAAAATGG + Intergenic
996521389 5:124430169-124430191 CAATTTTTTCATTGGCCCATTGG - Intergenic
997929049 5:138057361-138057383 CAATTTTACCACAGGCTAATTGG + Intergenic
1000903371 5:166935251-166935273 CTAATTTACAATAGGCCACTGGG - Intergenic
1001867743 5:175120215-175120237 CAATTTTTCCACAGACCAAAAGG + Intergenic
1007074309 6:39057124-39057146 CAATTTAAGAATAGGCCCATAGG + Intronic
1009524996 6:64732600-64732622 CAATTTTACTATACGCCACTAGG - Intronic
1016959803 6:149662456-149662478 CACTTCTACCATAGGCCAAAAGG - Intronic
1018558223 6:165072429-165072451 CAATTTTTTCATGGACCAATAGG - Intergenic
1019923487 7:4177676-4177698 CAATTTTTCCATAGACCAGGTGG + Intronic
1020192968 7:6014594-6014616 CATTTTCCCCATAGTCCAATAGG - Intronic
1023589647 7:41767626-41767648 CAAGTTTTCTATAGGCCATTTGG + Intergenic
1024371092 7:48584808-48584830 CAATTTTACCATAAGCTGATTGG - Intronic
1025030687 7:55554362-55554384 AATTTTTCCCATAGGCCAATAGG + Intronic
1025571679 7:62579979-62580001 CTATTTCACCATAGGCCATAAGG + Intergenic
1027858525 7:83544749-83544771 CATTCTTAACATAGGCCAGTAGG + Intronic
1028793351 7:94878005-94878027 CCATTTTAACATTAGCCAATAGG + Intergenic
1029723107 7:102383340-102383362 CATTTTCCCCATAGTCCAATAGG + Intronic
1030246360 7:107387990-107388012 GATTATTACCATAAGCCAATGGG - Intronic
1030838197 7:114314491-114314513 CAATTTTCACATAGTTCAATTGG + Intronic
1032633062 7:133674779-133674801 GAGTTTTACCATAGGCCCAAGGG - Intronic
1033780242 7:144660073-144660095 CCATTTTACCCTAGGCTAATTGG - Intronic
1037684621 8:21128453-21128475 CAATTTTCCCTTAGGCTCATTGG - Intergenic
1040750032 8:50693858-50693880 CAATTTTATCATTGACCCATTGG - Intronic
1041703396 8:60817475-60817497 GGACTTTACCATAGGCCAGTTGG - Intronic
1044165392 8:88976229-88976251 CAATTTTTCCATCGGACAAAGGG + Intergenic
1045176023 8:99725525-99725547 CAATTTTTCCATAGACCAAGGGG - Intronic
1045672200 8:104567550-104567572 AAATTTTATCATATGCAAATAGG - Intronic
1045903570 8:107314564-107314586 CAATTTTGCCTTAAGCCACTGGG + Intronic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1051965580 9:22825269-22825291 AAAATTTTCCATAGGGCAATAGG - Intergenic
1052199305 9:25758167-25758189 CAGTTTTATCAGAGGCCTATAGG + Intergenic
1052401322 9:28003778-28003800 CAATTTTACCACAGACCAATTGG - Intronic
1053543018 9:38994044-38994066 CAAGTTTAGCCTAGGGCAATGGG + Intergenic
1055955327 9:81767997-81768019 CAATTTCACTTTTGGCCAATTGG - Intergenic
1060313310 9:122484527-122484549 GTTCTTTACCATAGGCCAATAGG - Intergenic
1203412151 Un_KI270579v1:26295-26317 CTTTTTTACCATAGGCCACAAGG + Intergenic
1186498149 X:10028895-10028917 CAATTTGACCACAGGCTAATTGG - Intronic
1188409358 X:29852038-29852060 AAATTTTCCCATAGGCCCAGGGG + Intronic
1189553756 X:42120163-42120185 CAATTTTTCCACAGGGCAAAAGG + Intergenic
1191145833 X:57164290-57164312 GAATTTTATAATAGGCCCATTGG - Intergenic
1191263716 X:58359611-58359633 CTTTTTCACCATAGGCCTATAGG - Intergenic
1191268927 X:58436488-58436510 CTTTTTCACCATAGGCCACTTGG + Intergenic
1191629918 X:63311774-63311796 CACTTTTTCCATGGGCCCATTGG + Intergenic
1195636981 X:107128874-107128896 CAAATTTATCATTGGACAATGGG + Intronic
1196394640 X:115246242-115246264 CAATTTTTCCACAGACCAGTTGG + Intergenic
1197974041 X:132146306-132146328 CAATCATACCATTGGCAAATTGG - Intergenic
1198385632 X:136126739-136126761 TATTTTTACCATAAGCCTATAGG + Intergenic
1198914876 X:141658836-141658858 CAATTTTACCATAGATAAAATGG - Intronic
1201184315 Y:11383982-11384004 CAATTTTAGCATAGGCTAAATGG + Intergenic