ID: 977957144

View in Genome Browser
Species Human (GRCh38)
Location 4:103042124-103042146
Sequence CCCACAGTGAATGCTGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977957144 Original CRISPR CCCACAGTGAATGCTGTCTA TGG Intronic
900822731 1:4901722-4901744 CACACAGTGCAAGCTGTCAATGG + Intergenic
901613438 1:10517898-10517920 CCCAATTTGAATGCAGTCTAGGG + Intronic
902239050 1:15076112-15076134 CCCACAGTGACAGCTGTCAGAGG - Intronic
903140257 1:21335019-21335041 CCCACAGACAAGGCTGTCCATGG + Intronic
905651030 1:39657110-39657132 CCCACAGTGACTGCTTTATCAGG - Intergenic
908228558 1:62081143-62081165 CCAACAATGCATGCTGACTATGG + Intronic
911309524 1:96275899-96275921 CACACAGTGCAAGCTGTCTGTGG - Intergenic
911855673 1:102872219-102872241 CACACAGTGCAAGCTGTCGATGG + Intergenic
912300698 1:108513748-108513770 CCCACAGAGAATGCCATGTATGG - Intergenic
913056749 1:115169196-115169218 CCCACAGGGAATTCTATCAATGG + Intergenic
916164317 1:161951835-161951857 CACTCAGTAAATGCTGACTACGG + Intronic
917816407 1:178714210-178714232 CCCACATGGAATGATTTCTATGG - Intergenic
918591362 1:186245080-186245102 CACACAGTGCAAGCTGTCTGTGG + Intergenic
919989651 1:202700359-202700381 CACACAGTGAATGCTTAGTAAGG - Intronic
920854002 1:209648937-209648959 CCCACAGGGAGTCCTGGCTAGGG + Intronic
921933347 1:220773378-220773400 CCCAATGGAAATGCTGTCTAGGG - Intronic
923433796 1:233949650-233949672 GCCCCAGTGAATGCTGTAAAAGG - Intronic
924854209 1:247859141-247859163 CTCTCAGTGAAAGCTTTCTAGGG + Intronic
1062893708 10:1086752-1086774 CCCGTAGTTAATGCTGTCCACGG + Intronic
1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG + Intergenic
1063066303 10:2612668-2612690 CCCACAGTCTAAGCTGTCTAGGG + Intergenic
1064623427 10:17238636-17238658 CTCACACTGAGTGCTTTCTAGGG - Intergenic
1067107680 10:43376674-43376696 CACCCAGTGAATGCTCTCTATGG + Intergenic
1069552580 10:69374872-69374894 CCAACAGGGAAGGCTGCCTAGGG + Intronic
1071018768 10:81028261-81028283 CCTACAGAGAATGCTGAGTAGGG - Intergenic
1074206857 10:111290274-111290296 ACCACAATGTAGGCTGTCTAAGG + Intergenic
1075984106 10:126768404-126768426 CCCTCAAGGACTGCTGTCTATGG - Intergenic
1077748618 11:4937693-4937715 AACACAGTCAATGTTGTCTACGG - Intronic
1078451656 11:11444910-11444932 CCCACAGTCACTGCAGTCTCTGG - Intronic
1078874418 11:15378970-15378992 CCCACAGTGGAAGCTGTGTATGG + Intergenic
1080942278 11:36932685-36932707 CCTACAGTAAAGGCTGCCTATGG + Intergenic
1081002846 11:37695886-37695908 CACACAGTGAAAGCTGTCAGTGG - Intergenic
1081120008 11:39255109-39255131 CACACAGTGCAAGCTGTCAATGG + Intergenic
1082775965 11:57244734-57244756 CCCACAGTGAATCCTTTTTAAGG - Intergenic
1084331080 11:68431068-68431090 ACCACAGTGAAGCCTGTCCAGGG + Intronic
1093084925 12:14856299-14856321 CACACAGTGAAGCCTGTCAAAGG - Intronic
1095289059 12:40454795-40454817 CATACAGTGAATGCTTTCAAAGG + Intronic
1098630582 12:72717007-72717029 CCCACAGGAAATTTTGTCTAAGG - Intergenic
1106810361 13:33352878-33352900 CCCACAGGGGATGCTACCTAAGG - Intergenic
1107738821 13:43427256-43427278 GCCACAGTGACTGCTGTATAGGG - Intronic
1109827095 13:67735815-67735837 CCCACACTGAATGCAGTATTTGG + Intergenic
1109907668 13:68865944-68865966 GCTACAATGTATGCTGTCTAGGG - Intergenic
1110420819 13:75305670-75305692 CCCACAGTTTATGCAGGCTATGG + Intronic
1111144856 13:84166771-84166793 TGCACAGTGAAAGCTGTCAATGG + Intergenic
1113053384 13:106239482-106239504 ACCATACTGAATGCTGGCTATGG - Intergenic
1114706980 14:24737448-24737470 CACACAGTGCAAGCTGTCTGTGG + Intergenic
1115257814 14:31420948-31420970 CTCACAGTCAAGGCTCTCTAGGG - Intronic
1116510512 14:45740123-45740145 ACCACAGTGAATGCTGTGAGTGG - Intergenic
1119201375 14:72755274-72755296 AGCACAGTGACTGCTGTCTCAGG - Intronic
1121031844 14:90664851-90664873 CCCACAATGAAGGCTATCAATGG + Intronic
1124224356 15:27879017-27879039 CCCACACTGGATCCTGTCAAGGG - Intronic
1132851826 16:2028280-2028302 CCCAGAGTGTCTGCTGTGTAAGG + Intronic
1133910494 16:10061595-10061617 CCCACAGTGAAGTCAGTCTGGGG + Intronic
1138099803 16:54243687-54243709 GCCACAGTGAATGCTGGGGAAGG - Intergenic
1138422964 16:56911863-56911885 CACACAGTGAGTGCTCTGTAAGG - Intronic
1138807188 16:60104039-60104061 CCCACAGAGAATGCTGAGAAAGG - Intergenic
1138833654 16:60407149-60407171 CACACAGTGAAAGCTGCCTGTGG - Intergenic
1138983450 16:62298364-62298386 GCCAGATTGAATGCTGTCTTGGG + Intergenic
1140233171 16:73134668-73134690 CCCACAGTGGGTACTGTCTCAGG - Intronic
1140402850 16:74685630-74685652 ACCACACTGAATGTTCTCTAAGG - Intronic
1141785949 16:86201013-86201035 GCCACAGAGAATGGTGGCTAGGG + Intergenic
1144198846 17:12920881-12920903 GCCACAGGCAATGCTGTCTCAGG - Intronic
1152679165 17:81656795-81656817 ACCACAGTGTCTGCTGTCTTGGG + Intronic
1152806184 17:82357411-82357433 CCCACAGAGAAGCCTGTTTATGG - Intergenic
1152873125 17:82769490-82769512 CACTCAGTGAATGCTGACCAGGG - Intronic
1153594685 18:6713079-6713101 CACACAGTGAGTGCTGTATAAGG - Intergenic
1154167979 18:12030123-12030145 CCCAGTGTGAATGCAGTCAAGGG - Intronic
1160116528 18:76084386-76084408 CCCGCAGTGAAAGCTGTGTGAGG - Intergenic
1164447435 19:28330000-28330022 CCCACAGTGTAAGCTGTCAGTGG - Intergenic
1165427407 19:35753735-35753757 GCCTCAGGGAATCCTGTCTAGGG - Intronic
1167666929 19:50827678-50827700 CCCACACTGGGTGCTGTCTGCGG - Exonic
926445961 2:12943391-12943413 CCCACAATGAATGCGGCCTCTGG - Intergenic
930263154 2:49170476-49170498 CGCACAGTGCAAGCTGTCAATGG - Intergenic
935586775 2:104807651-104807673 CTCAAAGTGGATGCAGTCTAAGG - Intergenic
937454404 2:122028939-122028961 TCCACAGTCAGTGCTGTGTATGG + Intergenic
938010985 2:127828756-127828778 CACACAGTGCAAGCTGTCGATGG - Intergenic
941432423 2:165427774-165427796 CCCACAGTGGAAGCTGTTTGTGG + Intergenic
945022224 2:205585249-205585271 CACAAAGTAAATGCTGTCTTGGG + Intronic
945061071 2:205909376-205909398 CCCTCAGTGCCTGCTGTCTTGGG + Intergenic
946128305 2:217584180-217584202 CCCACAGTAAATCCTGTGTTAGG - Intronic
1168853876 20:995284-995306 CCCACAGCAAATCCTGCCTACGG - Intronic
1169386660 20:5155804-5155826 CCTCCTGTGATTGCTGTCTATGG - Intronic
1170337051 20:15281729-15281751 CCCACAGTGCAAGCTGTCAGTGG + Intronic
1170741864 20:19065404-19065426 CACACAGTGCATGCTGTCAGTGG - Intergenic
1173238581 20:41271603-41271625 CCCACAGTCAGTGCTGTTTTTGG - Intronic
1174574988 20:51530868-51530890 CCCACATTGAAGTCTATCTATGG + Intronic
1174910974 20:54607213-54607235 CCCACATAGACTCCTGTCTAGGG + Intronic
1177837670 21:26203499-26203521 CCCTCATTGCATGCTGTCTGTGG + Intergenic
1178207522 21:30486808-30486830 CACACAGTGGAAGCTGTCTGTGG - Intronic
1179255598 21:39712754-39712776 TCCACGGTGAATGCTGTCTTGGG + Intergenic
1180125710 21:45788638-45788660 CCCACAGTGAGTGAGGTCAATGG - Intronic
1180251434 21:46592687-46592709 CCCACAGTGCAAGCTGTCTGTGG - Intergenic
1183276199 22:36899809-36899831 CCCACTCTCAATGCTGCCTAAGG - Intergenic
1184403431 22:44286765-44286787 CCCAGAGTGGATGGTGTCCAGGG + Intronic
949673334 3:6424784-6424806 CCCACACTGTGTGCAGTCTAAGG - Intergenic
950570013 3:13793918-13793940 CCCTCAGTTAATGCTGGCCATGG + Intergenic
953517650 3:43611619-43611641 GCCACAGTGAATGGTGTGAAAGG + Intronic
953861863 3:46551184-46551206 CCCACAGTAAATGCTGTAGCAGG - Intronic
957054567 3:75434142-75434164 CCCACACTGAATGCTAACTTCGG - Intergenic
957156601 3:76551735-76551757 CCCACAGTGGAAGCTGCCTGTGG + Intronic
963268745 3:143265401-143265423 ACCACAGTGAATGTTGTTTAAGG + Exonic
966459636 3:180161970-180161992 TAGACAGTGATTGCTGTCTACGG - Intergenic
966656563 3:182364919-182364941 TCCTAAGTGAATGCCGTCTATGG - Intergenic
967835355 3:193958008-193958030 CCCACAGTGAATGCTGTGACGGG + Intergenic
969756637 4:9154242-9154264 CCCACACTGAATGCTAACTTGGG + Intergenic
971660679 4:29410757-29410779 CAAACTGTGAATGCTGTCCAGGG + Intergenic
971744874 4:30566653-30566675 CACACAGTGCAAGCTGTCGATGG - Intergenic
972200004 4:36702981-36703003 CACACAGTGCAAGCTGTCTGTGG - Intergenic
974316080 4:60282470-60282492 CCCACAGTACAAGCTGTCGAGGG - Intergenic
975259227 4:72276620-72276642 CCCAGAGTGAATGCTGGTAAGGG + Intergenic
977270989 4:94917225-94917247 CCCACTGGGAATGCTGTGTGGGG - Intronic
977637373 4:99314901-99314923 CCCACAATGAAGACTGACTATGG - Intronic
977957144 4:103042124-103042146 CCCACAGTGAATGCTGTCTATGG + Intronic
978232835 4:106421537-106421559 TCCACAGAGCATGCTGTCTCTGG + Intergenic
980708318 4:136529231-136529253 CACACAGTAAGTGCTGTATAAGG + Intergenic
982277609 4:153652411-153652433 CCCAGAGGGAATGATGACTAAGG - Intergenic
983891105 4:173031081-173031103 CCCACTGTGGATGCTGGCTTTGG + Intronic
986631181 5:9775578-9775600 CCCACAGTGAGTACTGTCTGGGG + Intergenic
986642415 5:9885400-9885422 CCTACAGTGATAGCTGTATAAGG - Intergenic
987161122 5:15144173-15144195 GCCACATCGAATGCTGTCTTAGG + Intergenic
987840874 5:23221346-23221368 GCCACATTGCAAGCTGTCTATGG + Intergenic
988074743 5:26338477-26338499 CACACAGTGTAAGCTGTCTTTGG + Intergenic
988610573 5:32720512-32720534 CCCACAGTGACTTCTGTAAATGG - Intronic
990365616 5:55067170-55067192 CCTAGAGTGAATGCTTACTAAGG - Intergenic
990622210 5:57571785-57571807 CCCCCAGTGAAGGCTCTGTATGG + Intergenic
993238316 5:85344948-85344970 CCCACTGAGAACTCTGTCTAGGG - Intergenic
993703934 5:91148728-91148750 CACACAGTGCATGCTGTTTGTGG - Intronic
993806239 5:92413483-92413505 CCCACAGTAAATTTTGTGTATGG + Intergenic
996806210 5:127457130-127457152 CCTACAGTGAGTGTTGTCCAAGG + Exonic
996913461 5:128681925-128681947 CCCAGAGTGACTGCTCTATAAGG - Intronic
997397824 5:133578453-133578475 CCCACAGAGAGTTCTGTCCAGGG + Intronic
997598693 5:135124802-135124824 CTCTCAGTTACTGCTGTCTAGGG - Intronic
998813901 5:145993296-145993318 CACACAGTGAAAGCTGTCAGTGG + Intronic
1002349192 5:178570984-178571006 CCCAGTGTGAATGCTGTCTGCGG - Intronic
1003002288 6:2347463-2347485 GCCAGAGAGAATGCTGTCTCTGG - Intergenic
1004570098 6:16836483-16836505 CCCACAGTAATTGCTGTCTGGGG + Intergenic
1006021483 6:31120492-31120514 CCCACAGTGACTCCTGCCCAGGG - Intronic
1006240446 6:32673161-32673183 CCCACAGTGCAAGCTGTCAGTGG - Intergenic
1009242477 6:61198943-61198965 CCCAGTGTGGATGCTGTGTAGGG - Intergenic
1009276332 6:61685811-61685833 CCCACTGTGAATGCTCCCCAAGG - Intronic
1009825285 6:68858789-68858811 CCCACACTGTGTGCAGTCTAGGG - Intronic
1010605988 6:77890171-77890193 CACACAGTGCAAGCTGTCTGTGG - Intronic
1016710415 6:147165038-147165060 CACACAGTGAAGTCTGTCTATGG - Intergenic
1017610129 6:156176644-156176666 CCCACAACTAATGCTGTCTGTGG + Intergenic
1017630400 6:156391308-156391330 ACCTCAGTGGATGCTGTCTGGGG - Intergenic
1018237969 6:161744425-161744447 CCCTCACTGAATGCTTGCTATGG + Intronic
1020200683 7:6077463-6077485 CCCACAGTGAGGGCTGGCTAGGG - Intergenic
1022243243 7:28532885-28532907 CCCACAGTAACTCTTGTCTAAGG - Intronic
1022964244 7:35457917-35457939 CACACAGTGCAAGCTGTCAATGG + Intergenic
1023460197 7:40387765-40387787 CCCTCAGTGAGTGCTATGTAAGG + Intronic
1023858817 7:44204076-44204098 CCCATAGTGAGTGCTGGCTCAGG - Intronic
1027687286 7:81294162-81294184 CCCACAGTGGAAGCTGTTTGTGG - Intergenic
1030615161 7:111731097-111731119 TCCAGAGTGAATGCTGTCACAGG + Intronic
1030712533 7:112767441-112767463 CGCACAGTGAAAGCAGTATATGG - Exonic
1030907626 7:115206425-115206447 CACACAGTGCAAGCTGTCTGTGG + Intergenic
1030984182 7:116221608-116221630 CCCACAGTGAAAGCTGTGGAAGG + Intronic
1033837709 7:145335624-145335646 TGCACAGTGAAAGCTGTCTGTGG + Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1036849689 8:12193103-12193125 CCCACACTGAATGCTAACTTGGG - Intronic
1036871053 8:12435376-12435398 CCCACACTGAATGCTAACTTGGG - Intronic
1038744489 8:30245607-30245629 CTCAAACTGTATGCTGTCTAGGG + Intergenic
1042193184 8:66208707-66208729 CCCACAATGGATGCTGGATATGG + Intergenic
1043510558 8:80946314-80946336 CACACAGTGAAAGCTGTCAGTGG - Intergenic
1048213480 8:132476352-132476374 CACACAGTGCAAGCTGTCTGTGG - Intronic
1048774402 8:137929916-137929938 GCCACTGTGACTGCTCTCTATGG - Intergenic
1048871983 8:138806746-138806768 CCCACAGCGCCTGCTGTCTGAGG + Intronic
1051276257 9:15401762-15401784 CACCCAGTGATTGCTCTCTATGG - Intergenic
1052594162 9:30537118-30537140 CTCACAGTGCAAGCTGTCAATGG - Intergenic
1053619686 9:39802646-39802668 CACACAGTGAAAGCTTTCAATGG - Intergenic
1054264472 9:62904797-62904819 CACACAGTGAAAGCTTTCAATGG + Intergenic
1055170777 9:73255270-73255292 CACACAGTGCAAGCTGTCTGTGG - Intergenic
1057461391 9:95265890-95265912 CCCACAGTGTAATCTGTGTATGG - Intronic
1058540144 9:106003187-106003209 GCCACTGTGGATGGTGTCTAGGG + Intergenic
1059916452 9:119107901-119107923 ATCACAGTGAATGCTTTCTAAGG - Intergenic
1190825892 X:54017681-54017703 CTCACAGTGAATGATGGCGAGGG + Exonic
1191595883 X:62943829-62943851 CCCACAGTGCAAGCTGTCAGTGG + Intergenic
1194320641 X:92441834-92441856 CACACAGTGAAAGCTGTCAGTGG - Intronic
1197770533 X:130086517-130086539 CCCACAGTGTAGACTGCCTAGGG + Intronic
1199106624 X:143876039-143876061 CCCACAGTGCAAGCTGTCAGTGG - Intergenic
1199270652 X:145879163-145879185 CCCTCAGTGAATGTTGTTCAAGG - Intergenic
1200497496 Y:3902794-3902816 CCCACCATGAACTCTGTCTAAGG - Intergenic
1200628755 Y:5554970-5554992 CACACAGTGAAAGCTGTCAGTGG - Intronic
1201469451 Y:14317695-14317717 CCCATACTGCATGCAGTCTAGGG + Intergenic
1201742805 Y:17342164-17342186 CACACATAGAATGCTGGCTAAGG + Intergenic