ID: 977963869

View in Genome Browser
Species Human (GRCh38)
Location 4:103119746-103119768
Sequence CTGAATCTGACCTGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977963869_977963880 12 Left 977963869 4:103119746-103119768 CCCCCAAAACAGGTCAGATTCAG 0: 1
1: 0
2: 0
3: 17
4: 212
Right 977963880 4:103119781-103119803 CAGGTGGGACTCAGTAACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 145
977963869_977963876 -4 Left 977963869 4:103119746-103119768 CCCCCAAAACAGGTCAGATTCAG 0: 1
1: 0
2: 0
3: 17
4: 212
Right 977963876 4:103119765-103119787 TCAGCCCATGGGATATCAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 110
977963869_977963877 -3 Left 977963869 4:103119746-103119768 CCCCCAAAACAGGTCAGATTCAG 0: 1
1: 0
2: 0
3: 17
4: 212
Right 977963877 4:103119766-103119788 CAGCCCATGGGATATCAGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 96
977963869_977963881 23 Left 977963869 4:103119746-103119768 CCCCCAAAACAGGTCAGATTCAG 0: 1
1: 0
2: 0
3: 17
4: 212
Right 977963881 4:103119792-103119814 CAGTAACAGAGGCAGTAAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 240
977963869_977963875 -7 Left 977963869 4:103119746-103119768 CCCCCAAAACAGGTCAGATTCAG 0: 1
1: 0
2: 0
3: 17
4: 212
Right 977963875 4:103119762-103119784 GATTCAGCCCATGGGATATCAGG 0: 1
1: 0
2: 0
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977963869 Original CRISPR CTGAATCTGACCTGTTTTGG GGG (reversed) Intronic
900036972 1:421548-421570 CTGAAGATGCCCTGTTTTAGAGG - Intergenic
900058601 1:657289-657311 CTGAAGATGCCCTGTTTTAGAGG - Intergenic
900898281 1:5498880-5498902 CTGAGTCTTCCTTGTTTTGGGGG - Intergenic
901093088 1:6656162-6656184 CTGAAGCTGATCTTTTTAGGGGG + Intronic
905368309 1:37467984-37468006 GTGAATCTCACCAGTTTTGAAGG - Intergenic
905635651 1:39549848-39549870 ATGAATCTGAGCTCTTTGGGTGG - Intergenic
905851283 1:41277043-41277065 CAGCATCTCACCTGTTTTAGAGG + Intergenic
906599018 1:47107549-47107571 TTGACTCTGAGCTGTTTTGTTGG - Intronic
907867642 1:58413766-58413788 CTGACTCTGTTCTGTTTAGGGGG - Intronic
908725001 1:67166279-67166301 CTGAAAGTGAACTGTTTTGTCGG - Intronic
909101830 1:71357948-71357970 GTGGATCTGCCCTGTTCTGGTGG + Intergenic
911702599 1:100971437-100971459 CAGAATCTGACCTCCTTTGGAGG + Intronic
914876301 1:151514747-151514769 GTGGATCTGACCTGGTTTGTGGG + Intronic
915615803 1:157037227-157037249 CTGAATCAGAACGGTTATGGTGG - Intronic
916006348 1:160664756-160664778 CTGATTGTGGCCTTTTTTGGTGG + Intergenic
919637217 1:200014610-200014632 CTGAATCTGGCCAGTTGTGGTGG - Intergenic
921068740 1:211641762-211641784 CTGAATCTGCTGTGATTTGGGGG - Intergenic
922821924 1:228490501-228490523 TTCAATCTGTCCTGTTTTGGGGG + Intronic
923997635 1:239513215-239513237 CTTAATCTGATCTTATTTGGGGG + Intronic
924171635 1:241348298-241348320 CTTAGTCTGACCTATTCTGGTGG - Intronic
1063136617 10:3222520-3222542 CCGAAACTGACCTGTTTTAAAGG - Intergenic
1065068232 10:21995169-21995191 CTTAACCTGACCTGTTTTAATGG + Intronic
1065695262 10:28373740-28373762 CTGAAATTGGCCTTTTTTGGGGG - Intergenic
1066354293 10:34666690-34666712 TTCAATCTGACCTTGTTTGGAGG + Intronic
1071411774 10:85404063-85404085 ATGAATCAGATTTGTTTTGGGGG + Intergenic
1071672707 10:87624483-87624505 CTGAACCTGTTTTGTTTTGGGGG + Intergenic
1074295818 10:112187779-112187801 CAGAATATGACCTATCTTGGTGG - Intronic
1075215449 10:120528737-120528759 CTGAATCAGACCTCTTTGGAGGG + Intronic
1076762512 10:132612439-132612461 GTGAAGGTGCCCTGTTTTGGGGG + Intronic
1079896725 11:26128635-26128657 ATGAAGCTGACCATTTTTGGGGG - Intergenic
1082755548 11:57072486-57072508 CAGAATATGACCTTGTTTGGAGG - Intergenic
1084468641 11:69342291-69342313 CTGCATCTGATCTGTTCTGGAGG + Intronic
1086972472 11:93098425-93098447 CTGAATCTTAACTGTTTTTAAGG + Intergenic
1087614516 11:100472391-100472413 GTGAATTTGAGCTGTTTTTGTGG - Intergenic
1088101154 11:106157190-106157212 CAGAATCTGACAAGTTCTGGTGG + Intergenic
1088291447 11:108242662-108242684 GTAAATCTGTCCTGTTTTAGAGG - Intronic
1089383872 11:118055512-118055534 CTGAATGTGATGTCTTTTGGTGG + Intergenic
1090430956 11:126646118-126646140 CTAATGCTGACCTGTTTGGGGGG - Intronic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1095269865 12:40205080-40205102 CTGAACCTATCCTGGTTTGGAGG - Intronic
1095667045 12:44814622-44814644 CAGATTCTGGCCTGTTTTTGAGG - Intronic
1096581695 12:52589777-52589799 CAGAAACTGACTTGCTTTGGTGG - Intronic
1096772370 12:53944154-53944176 CAGAATTTGTTCTGTTTTGGTGG + Intronic
1097963956 12:65559271-65559293 CTGAATCTGAACTTTTTTAATGG - Intergenic
1100220187 12:92496565-92496587 CTGAACCTGAGCTGTTTAGGAGG + Intergenic
1101970279 12:109307993-109308015 CAGAAACGGACCTCTTTTGGAGG + Intronic
1103221196 12:119247145-119247167 CTGGATCAGACCTGATCTGGTGG - Intergenic
1106067336 13:26367778-26367800 CTGGATCTGAGATGTTTTGAAGG - Intronic
1107234326 13:38150806-38150828 CAGAATCTGACTGTTTTTGGAGG - Intergenic
1111301402 13:86355396-86355418 CTTAATATTACTTGTTTTGGGGG + Intergenic
1112431528 13:99354698-99354720 CTGAGTCTGTCCTGTTTTGCAGG - Intronic
1114308458 14:21444348-21444370 CTGAAACTAAACTATTTTGGAGG - Intronic
1114623939 14:24116187-24116209 CTGACTCTAACCTGTTCTTGAGG + Intronic
1115394494 14:32892417-32892439 GGGGATCTGACCTGGTTTGGTGG - Intergenic
1115976144 14:38999291-38999313 CTGAAACTGCTCTGGTTTGGGGG - Intergenic
1117373188 14:55097344-55097366 ATGAATCTGGCCTGTTGTGGAGG + Intergenic
1117525644 14:56600191-56600213 CGGAATATGAAATGTTTTGGAGG - Intronic
1118060388 14:62131590-62131612 CTGAAACTGAGCTCTTTGGGTGG + Intergenic
1119993306 14:79224634-79224656 CAGAATGTGACCTTATTTGGAGG + Intronic
1122257039 14:100486060-100486082 CTAAATATAACGTGTTTTGGCGG - Intronic
1123579537 15:21703898-21703920 CTGAACATGACCTGTTTTTCAGG - Intergenic
1123616164 15:22146409-22146431 CTGAACATGACCTGTTTTTCAGG - Intergenic
1124402781 15:29364691-29364713 CTGAATGTATCCTGGTTTGGGGG + Intronic
1125154366 15:36569391-36569413 CTGAGTATGACCTCTCTTGGTGG - Intergenic
1129007289 15:72384505-72384527 CTGCACCTGGCCTGTTTTGAGGG + Intergenic
1129224349 15:74158357-74158379 CTGAATCTCACCAGTCTAGGAGG + Intergenic
1129803898 15:78438345-78438367 CCGAAACTGACCTGCTTTTGGGG - Exonic
1130263051 15:82374670-82374692 TTGAATCTGTGCTGTTTTGGTGG - Intergenic
1130278241 15:82494993-82495015 TTGAATCTGTGCTGTTTTGGTGG + Intergenic
1130470570 15:84222178-84222200 TTGAATCTGTGCTGTTTTGGTGG + Intergenic
1130478058 15:84336745-84336767 TTGAATCTGTGCTGTTTTGGTGG + Intergenic
1130493707 15:84451385-84451407 TTGAATCTGTGCTGTTTTGGTGG - Intergenic
1130592857 15:85226804-85226826 TTGAATCTGTGCTGTTTTGGTGG + Intergenic
1131532725 15:93207477-93207499 ATGAATCTGACCAGATGTGGTGG + Intergenic
1132354605 15:101162112-101162134 CTGAATATGATGGGTTTTGGAGG - Intergenic
1132444860 15:101905705-101905727 CTGAAGATGCCCTGTTTTAGAGG + Intergenic
1202988407 15_KI270727v1_random:438143-438165 CTGAACATGACCTGTTTTTCAGG - Intergenic
1133480895 16:6169516-6169538 CTGAATCTGCCCTGATTCTGGGG - Intronic
1137466286 16:48712774-48712796 CTGAACCTGTTCTGGTTTGGGGG + Intergenic
1138305229 16:55968550-55968572 CTGAATCTGTTCTGGTTTTGAGG + Intergenic
1138944959 16:61837917-61837939 CTGAGTCTGACCTTCCTTGGAGG + Intronic
1140432662 16:74917867-74917889 CTGAATCTTACACTTTTTGGTGG + Intronic
1144173082 17:12678639-12678661 ATGAATATGATCTTTTTTGGTGG - Intronic
1145075905 17:19854549-19854571 CAGACTCTTACCTGTTTTTGAGG - Intronic
1146438186 17:32871010-32871032 GTGACATTGACCTGTTTTGGGGG + Intronic
1147201047 17:38801354-38801376 CTGAATCTGGCTGGTTTAGGAGG - Exonic
1148604329 17:48917408-48917430 TTAATTCTGACCTGCTTTGGGGG + Intronic
1149032313 17:52098059-52098081 CTGCAGCTGGCCTGTTTTGATGG + Intronic
1153299939 18:3583658-3583680 CTGAATCTGACTGGGTGTGGTGG + Intronic
1155273631 18:24165084-24165106 CTGACTTGGACCTGTTTTTGCGG + Exonic
1160640501 19:129101-129123 CTGAAGATGCCCTGTTTTAGAGG - Intergenic
1162164116 19:8740492-8740514 CTGAAGATGACCTGTGGTGGGGG + Intergenic
1162165186 19:8747967-8747989 CTGAAGATGACCTGTGGTGGGGG + Intergenic
1162166251 19:8755421-8755443 CTGAAGATGACCTGTGGTGGGGG + Intergenic
1162167317 19:8762877-8762899 CTGAAGATGACCTGTGGTGGGGG + Intergenic
1162168259 19:8769177-8769199 CTGAAGATGACCTGTGGTGGGGG + Intergenic
1162169326 19:8776630-8776652 CTGAAGATGACCTGTGGTGGGGG + Intergenic
1162170005 19:8781942-8781964 CTGAAGATGACCTGTGGTGGGGG + Intergenic
1163654779 19:18539360-18539382 CTGACTCTCACCTGCCTTGGGGG + Exonic
1163833222 19:19557772-19557794 CAGAATTTGACCTGGGTTGGGGG + Intergenic
1166980849 19:46631241-46631263 CTGAATGGGACCTGGGTTGGGGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926873907 2:17453754-17453776 ATGTATCTGCACTGTTTTGGAGG + Intergenic
926976945 2:18524936-18524958 CTGAATCAGACAGGATTTGGGGG + Intergenic
927143714 2:20146693-20146715 TTTTATTTGACCTGTTTTGGGGG - Intergenic
928283733 2:29971066-29971088 CTCAATATTACCTGTTTTGAAGG - Intergenic
929831423 2:45349834-45349856 TTGAATCTGACCAGTTCTGAAGG - Intergenic
931372691 2:61678341-61678363 CTGAACCTGTTCTGGTTTGGGGG + Intergenic
933957263 2:87381513-87381535 CTGGTTCTGGCCAGTTTTGGAGG + Intergenic
934241381 2:90273405-90273427 CTGGTTCTGGCCAGTTTTGGAGG + Intergenic
934271793 2:91543281-91543303 CTGGTTCTGGCCAGTTTTGGAGG - Intergenic
936613372 2:114023792-114023814 CTGAAGCTGACCTGGCTTGAAGG + Intergenic
937422644 2:121771359-121771381 CTAAATCTCACCTCTTTCGGTGG - Intergenic
939276928 2:140010905-140010927 CTGTATGTGACCTTTTTTGCTGG - Intergenic
939715928 2:145583553-145583575 CTTCATCTAAACTGTTTTGGGGG - Intergenic
941097542 2:161256670-161256692 ATGACTGTGACCTCTTTTGGAGG - Intergenic
943404714 2:187465825-187465847 CAGAAACTGACATGTCTTGGAGG + Exonic
944775595 2:202960834-202960856 CTGAAACTGATTTTTTTTGGTGG - Intronic
945238023 2:207650750-207650772 ATGATTTAGACCTGTTTTGGGGG - Intergenic
1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG + Intergenic
1174532345 20:51224159-51224181 CCAAAACTAACCTGTTTTGGAGG - Intergenic
1174851623 20:54001035-54001057 GTGAATCTTACCTGTTTGGGTGG + Intronic
1178220705 21:30655833-30655855 CTGAGTCTGGGCTTTTTTGGGGG - Intergenic
1178727463 21:35066777-35066799 CTGAATCTATTCTGGTTTGGGGG + Intronic
1179118085 21:38513336-38513358 CTGAATATTCCCTGTTTTTGGGG - Intronic
1179489601 21:41732215-41732237 CTGAATCTGCCTTGTTTTCTTGG - Intergenic
1179790789 21:43754839-43754861 CTGAAACTGACTTGTTGGGGAGG - Intronic
1180239350 21:46489968-46489990 CTTGATCTGCCCTGATTTGGAGG + Intronic
1180591094 22:16937980-16938002 CTGCAGCTGACCGCTTTTGGTGG + Intergenic
1182061207 22:27399074-27399096 GTGAAGCTGAGCTGTTTTGCAGG + Intergenic
1183684398 22:39353230-39353252 CTGAAGCTTACATGATTTGGGGG - Intronic
949303503 3:2612437-2612459 CTGAATGTGTATTGTTTTGGGGG + Intronic
951960173 3:28309327-28309349 ATGAATTTGTTCTGTTTTGGTGG - Intronic
952692847 3:36230217-36230239 CTAAATCTAACCTGTTCTGCAGG + Intergenic
959912363 3:111778165-111778187 CAGAATGTGACCTTATTTGGAGG + Intronic
961694724 3:128696719-128696741 CTGCACCTGGCCTGTTTTGTGGG - Intergenic
961976704 3:131032816-131032838 GTGAATCTGTGCTGTTTTTGAGG - Intronic
962002857 3:131317605-131317627 CAGAATCTGACCAGCTGTGGTGG + Intronic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
968207785 3:196819740-196819762 CTCAATCTCACCTGTAATGGAGG - Intronic
970699640 4:18720445-18720467 CTGAATCTGCTGTGATTTGGGGG + Intergenic
974338858 4:60587829-60587851 TTTAATTTGACATGTTTTGGGGG - Intergenic
976087046 4:81417542-81417564 CTGAATGTGACCTCACTTGGAGG - Intergenic
977963869 4:103119746-103119768 CTGAATCTGACCTGTTTTGGGGG - Intronic
980069345 4:128226964-128226986 CTGCATCTGCCCTGTTTAGCAGG - Intergenic
984447429 4:179854628-179854650 CTGAATCTGATCTGTTCCGTTGG - Intergenic
984453838 4:179939696-179939718 CAGAATCTGACATTTTTTTGAGG - Intergenic
985004947 4:185524976-185524998 TTAAATCTGATCTGTTTTGCAGG - Intronic
985797485 5:1973751-1973773 CTGAATGTGAACTGTTTTCTTGG + Intergenic
986601957 5:9481345-9481367 CTGAAGTGGACCTATTTTGGTGG + Intronic
987320988 5:16769063-16769085 CATAATCTTACCTGTTTTGAAGG + Exonic
989264162 5:39453746-39453768 CTGAAGATGACATATTTTGGGGG + Intronic
989751077 5:44894769-44894791 CTGAAGCTGAAATGTGTTGGGGG - Intergenic
990516352 5:56534496-56534518 CTGAATCTGAACTATTTCTGTGG - Intronic
991019341 5:61963735-61963757 ATGAATTTAACCTGTTTTAGTGG - Intergenic
991132307 5:63136661-63136683 CTGAATATGACTTTGTTTGGAGG + Intergenic
993967615 5:94376718-94376740 CTGAGTCTGAGGTCTTTTGGTGG + Intronic
996464752 5:123786744-123786766 CTGACTCTGACTTGTGTTTGAGG - Intergenic
997719385 5:136065678-136065700 GGGAATCTGACCTTCTTTGGTGG - Intergenic
998667706 5:144317295-144317317 CTGAATATGAACTGCTTTGGAGG + Intronic
998926230 5:147129085-147129107 CTGAATCTGTTCTGGTTTGTAGG + Intergenic
1002736849 5:181397318-181397340 CTGAAGATGCCCTGTTTTAGAGG + Intergenic
1002747850 6:77504-77526 CTGAAGATGCCCTGTTTTAGAGG - Intergenic
1003505036 6:6733848-6733870 CTGAGGCTGAACTGTTGTGGGGG - Intergenic
1005147883 6:22712558-22712580 GTGAAGATGAACTGTTTTGGAGG + Intergenic
1005652425 6:27896409-27896431 CTGCACCTGGTCTGTTTTGGGGG + Intergenic
1006652337 6:35562019-35562041 TTTAATCTGTGCTGTTTTGGTGG - Intergenic
1007277114 6:40682584-40682606 CTGAATTTGACTTTTTGTGGTGG + Intergenic
1010322352 6:74527274-74527296 ATGAATCAGGCCAGTTTTGGTGG + Intergenic
1010479255 6:76330130-76330152 CTGAATCTGCCGTGTTTCTGGGG - Intergenic
1010931060 6:81803723-81803745 CTGTGTCTGACCTGATTTAGGGG + Intergenic
1013089815 6:106890117-106890139 CTGAATCTAACCAATTCTGGGGG + Intergenic
1015212220 6:130711329-130711351 CTGAATATCACTTGTTTTGTGGG - Intergenic
1017710116 6:157160100-157160122 GCGAATGTGACCTGTTTTCGAGG - Intronic
1017929038 6:158936655-158936677 CTGTACCTGACCTGTTTTTTTGG - Intergenic
1019241948 6:170672847-170672869 CTGAAGATGCCCTGTTTTAGAGG + Intergenic
1021582312 7:22169565-22169587 CTGAATCTGGCCAGGTGTGGTGG + Intronic
1021854381 7:24839361-24839383 CTAAATCAGAGCTGTTTGGGGGG + Intronic
1022399923 7:30027290-30027312 ATGAATCAGACCTGGTTTGAAGG - Intergenic
1023765684 7:43508379-43508401 CTGAATCTTTCCTTTTTAGGTGG + Intronic
1023901467 7:44484041-44484063 CTCTTTCTGACGTGTTTTGGGGG - Intronic
1023915097 7:44582566-44582588 CGGAATCTGACCAGGCTTGGTGG + Intergenic
1029017421 7:97328736-97328758 CTGAATCTATTCTGGTTTGGGGG - Intergenic
1029109967 7:98208558-98208580 CTGAATTAGTCCTGTTTTGGTGG + Exonic
1030167703 7:106571418-106571440 TTTATTCTGACCTGTCTTGGTGG + Intergenic
1030665318 7:112271513-112271535 CTGAATCTCAGGTGTTTTGCAGG + Intronic
1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG + Intronic
1032007494 7:128314753-128314775 CTGCATCTCACCTGATTTTGGGG + Exonic
1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG + Intergenic
1033393635 7:140952582-140952604 CTGAGTCTGCCCTGTATTTGTGG + Intergenic
1033735938 7:144221889-144221911 CTTAATCAGTCCTGTATTGGTGG + Intergenic
1033747113 7:144329063-144329085 CTTAATCAGTCCTGTATTGGTGG - Intergenic
1034030877 7:147762450-147762472 CTGAATCTGAGCTGCTGCGGAGG + Intronic
1034247593 7:149659934-149659956 ATGTATCTGTACTGTTTTGGGGG + Intergenic
1035506170 8:135249-135271 CTGAAGATGCCCTGTTTTAGAGG - Intergenic
1037635167 8:20695084-20695106 CCGAATCTGACCTAGATTGGAGG - Intergenic
1037661181 8:20928107-20928129 CAGAATTTTACCTGCTTTGGTGG + Intergenic
1038771159 8:30481660-30481682 CTAATTCTGTCCTGTTTTGTGGG + Intronic
1040349213 8:46546240-46546262 CTGAGTCTGAACAGTTTTGTTGG + Intergenic
1042151415 8:65789995-65790017 CTGAATCTGACCTAGTTAAGAGG + Intronic
1042321452 8:67479572-67479594 CTGAATATTACCTGTGGTGGTGG + Intronic
1044690606 8:94873663-94873685 TTGAATTTGAGGTGTTTTGGGGG - Intronic
1048165958 8:132061675-132061697 CTGAATGTGTCCTGATTTAGGGG - Intronic
1050317418 9:4417267-4417289 CTGAATTTGAACTGTGTTGTTGG + Intergenic
1050644276 9:7702410-7702432 CTGAACCTGTCCTGGATTGGAGG - Intergenic
1050748951 9:8913820-8913842 GTGATTATGACCTGCTTTGGGGG + Intronic
1051536477 9:18164033-18164055 CTGATTCTGACTTGTGGTGGTGG + Intergenic
1051688199 9:19680898-19680920 CAGAATCTGACCACTTCTGGAGG + Intronic
1053099964 9:35363478-35363500 CTGGAGCTGCACTGTTTTGGAGG + Intronic
1054760568 9:69000732-69000754 CAGAATGTGACCTTATTTGGAGG - Intronic
1056586525 9:87931053-87931075 CTGCATCTGACCTCCCTTGGTGG - Intergenic
1056610353 9:88121889-88121911 CTGCATCTGACCTCCCTTGGTGG + Intergenic
1057637875 9:96787671-96787693 CTGGATCCAACCCGTTTTGGGGG + Intergenic
1060887874 9:127168329-127168351 CTGGCTCTGGTCTGTTTTGGAGG + Intronic
1062075111 9:134583855-134583877 CTGAATTAGTCCTATTTTGGTGG - Intergenic
1203602139 Un_KI270748v1:22081-22103 CTGAAGATGCCCTGTTTTAGAGG + Intergenic
1186358577 X:8813787-8813809 CAGGCTCTGTCCTGTTTTGGGGG + Intergenic
1186450813 X:9672133-9672155 CAGAATCTGACCATTTTTGTGGG - Intronic
1188074842 X:25762435-25762457 CAGAATCTGAACTGTTTTTCCGG - Intergenic
1189996523 X:46644346-46644368 CTGAATCTGGCCGGGTGTGGTGG + Intronic
1190335055 X:49257265-49257287 CTGCACCTGACGTTTTTTGGAGG + Intronic
1190648369 X:52544223-52544245 CAGAATCTGTCCTCTGTTGGGGG - Intergenic
1190936489 X:55002923-55002945 TTGAAACTGACCCCTTTTGGGGG + Intronic
1193104002 X:77648326-77648348 CAGAATATGATCTGTCTTGGTGG - Intronic
1193912701 X:87325474-87325496 TTGTATTTGACCTGTTTTGGGGG + Intergenic
1193957908 X:87885681-87885703 CTGGACCTGCCCTGTTCTGGAGG - Intergenic
1194090891 X:89581149-89581171 CTTAATCTGACCTATGATGGGGG + Intergenic
1194470401 X:94287362-94287384 CTGAAACAGACCTGTTTTAAAGG + Intergenic
1198399883 X:136258736-136258758 CTGAATCTGACCAATTTTCCCGG - Intergenic
1200443542 Y:3237212-3237234 CTTAATCTGACCTATGATGGGGG + Intergenic