ID: 977967948

View in Genome Browser
Species Human (GRCh38)
Location 4:103177417-103177439
Sequence AAGAGTCAAGAGAAGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 628}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977967948_977967954 30 Left 977967948 4:103177417-103177439 CCACCATTCTTCTCTTGACTCTT 0: 1
1: 0
2: 3
3: 40
4: 628
Right 977967954 4:103177470-103177492 TGACTCTCTCGGCAACCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 70
977967948_977967952 19 Left 977967948 4:103177417-103177439 CCACCATTCTTCTCTTGACTCTT 0: 1
1: 0
2: 3
3: 40
4: 628
Right 977967952 4:103177459-103177481 CTCATCTTATTTGACTCTCTCGG 0: 1
1: 0
2: 2
3: 18
4: 205
977967948_977967953 29 Left 977967948 4:103177417-103177439 CCACCATTCTTCTCTTGACTCTT 0: 1
1: 0
2: 3
3: 40
4: 628
Right 977967953 4:103177469-103177491 TTGACTCTCTCGGCAACCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977967948 Original CRISPR AAGAGTCAAGAGAAGAATGG TGG (reversed) Intronic
901172342 1:7268250-7268272 AAGAGTACAGAGGAGAAGGGGGG + Intronic
901539423 1:9905737-9905759 ACGAGTCAACAAAAGAATGTAGG - Intronic
904191877 1:28751380-28751402 AAGAGTCAATAAAACAGTGGTGG - Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904311203 1:29630732-29630754 AAGAAGGAAGAGAAGAAGGGGGG - Intergenic
904580187 1:31537477-31537499 TAGAAGCAAGAGTAGAATGGTGG + Intergenic
905099705 1:35508796-35508818 AATAGTTATGAGAAGAATGAAGG - Intronic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905948362 1:41923447-41923469 AGGAGTAGAGAGTAGAATGGTGG + Intronic
906155433 1:43611472-43611494 CTGAGCCAAGAGAAGACTGGAGG + Intronic
906391059 1:45416771-45416793 AAATGTGGAGAGAAGAATGGTGG - Intronic
906996967 1:50806689-50806711 AAGAGTCCAGACAAGAATGCCGG + Intronic
909125658 1:71665638-71665660 AAGAGTTTAGTGAAGAATGATGG - Intronic
909511721 1:76460927-76460949 ATGGGTAAAGAGAGGAATGGTGG + Intronic
910537147 1:88311253-88311275 AAGGGTCAAGAGTAGAATACAGG - Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
910937810 1:92500152-92500174 AAGAGCAGAGAGTAGAATGGTGG - Intergenic
910946807 1:92601662-92601684 AAAAGTACAGAGTAGAATGGTGG + Intronic
911480912 1:98439355-98439377 AAAAGTGAAGAGAAGAAGGCAGG + Intergenic
911836565 1:102626429-102626451 AGAAGTCAAGAGTAGAATGATGG - Intergenic
912099395 1:106186754-106186776 AAGAATAGAGAGAACAATGGAGG + Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912691186 1:111805665-111805687 AAGAGTCAAGCGAGGAGCGGGGG + Intronic
912986279 1:114435604-114435626 AAGAGGTACAAGAAGAATGGAGG + Intronic
913076456 1:115344423-115344445 AGGAGCCAGGAGAAGAATGCTGG + Intergenic
913998250 1:143669303-143669325 AAAACTCAAGAGAAGAAGGAAGG - Intergenic
914508742 1:148311654-148311676 AAAACTCAAGAGAAGAAGGAAGG - Intergenic
914778703 1:150763248-150763270 AAAAGTAGAGAGTAGAATGGTGG + Intronic
915536083 1:156536432-156536454 AGGAGTAGAGAGTAGAATGGTGG + Intronic
915587097 1:156849714-156849736 GAGAGTCGAGGGAAGGATGGGGG - Intronic
915811245 1:158914186-158914208 AGAAGTCAAGAGTAGAATCGTGG + Intergenic
916150725 1:161786399-161786421 AAGAGACAAAAGAAAAATTGGGG - Intronic
916208473 1:162338331-162338353 AGGAGAAAAGAGAATAATGGGGG - Intronic
916288731 1:163140006-163140028 GAGAGTCCAGAGAACAAAGGAGG - Intronic
916676668 1:167069564-167069586 AAGAGTCAAGAAAATAAAGTGGG - Intronic
917775013 1:178324113-178324135 ATGATTCAAAAGAAGAATGCAGG + Intronic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917902009 1:179552043-179552065 AAGAGGAAAGTGAAGAATGAAGG - Intronic
918119033 1:181521511-181521533 CAGAGTCAGGAGAAGACAGGAGG + Intronic
918760224 1:188394970-188394992 AAGAGGAAAGAAAAGAATAGTGG - Intergenic
919158134 1:193793329-193793351 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
919525662 1:198646817-198646839 AAAAGTAAAGAGAAGAATCAAGG + Intronic
919750827 1:201037057-201037079 AAGAGAAAAGAGGAGATTGGAGG + Intergenic
920107356 1:203563427-203563449 ATGAGTCAAGAGAAAAAGAGTGG - Intergenic
921302188 1:213761993-213762015 AAGAATGAAGAGCAAAATGGTGG + Intergenic
921442386 1:215202986-215203008 AGGAGGGAGGAGAAGAATGGGGG - Intronic
922072616 1:222210724-222210746 AAGTCTCAAGGAAAGAATGGGGG - Intergenic
922417818 1:225437883-225437905 AAGGGCCAAGAGATGAAAGGGGG - Intergenic
922900648 1:229133978-229134000 AAGAGTCAAGTGCAGAGTGAAGG - Intergenic
923173473 1:231439675-231439697 AAGAGTCTCTAGAAGAGTGGTGG - Intergenic
923322190 1:232845585-232845607 CAGAGTCAAGGGAAGAAAGATGG - Intergenic
923457961 1:234181577-234181599 AAGAGGCAAGGAAAAAATGGAGG - Intronic
923642081 1:235773593-235773615 ATTAGTCAAAAGTAGAATGGTGG + Intronic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063280297 10:4621372-4621394 TAGAGTATAGAGTAGAATGGTGG + Intergenic
1063301100 10:4849571-4849593 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1064526297 10:16260339-16260361 AAGAATGAAGAGAGGAAGGGAGG + Intergenic
1064829763 10:19449676-19449698 AAGAACAAAGAGAAGATTGGAGG + Intronic
1065762933 10:28999828-28999850 AAAATTCAAGAGAAGAATGGAGG - Intergenic
1066594322 10:37032590-37032612 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1066600083 10:37095086-37095108 AAAGTTCTAGAGAAGAATGGTGG + Intergenic
1067834619 10:49630696-49630718 AAGAGATAGGAGATGAATGGAGG + Intronic
1067927450 10:50524454-50524476 CACAGTCAAGAGAAGAAAGGAGG - Intronic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068642742 10:59428493-59428515 AAAAGACAAGAGAAGAAATGAGG + Intergenic
1068877610 10:62013606-62013628 AGGAGTAGAGAGTAGAATGGTGG - Intronic
1069075343 10:64033253-64033275 AGGAGGCAAGAGAAAAATAGAGG - Intergenic
1069760092 10:70804124-70804146 AAGAGAAAAGGAAAGAATGGAGG + Intergenic
1070411143 10:76141977-76141999 ATGAGTCAAGAGTAGAATCTAGG - Intronic
1070820850 10:79353304-79353326 AAGAGTCAAAGGAACAAGGGTGG - Intronic
1071557871 10:86619838-86619860 CTGTGTCAAGAAAAGAATGGTGG + Intergenic
1072469569 10:95699640-95699662 AAGAGAGAAGAAAAGAAAGGAGG + Intergenic
1073108201 10:101045237-101045259 AAGAGACAAGAGAAGAGGGAGGG - Intergenic
1074788954 10:116866955-116866977 AAGACTTAATAGAAGAATCGCGG - Intronic
1076414594 10:130276828-130276850 AAGAACAAAGAGAAGATTGGGGG - Intergenic
1077904240 11:6516863-6516885 AAGAGTAATGGGAAGAATAGAGG - Intronic
1077946289 11:6903801-6903823 AAGATGTAAGAGAAAAATGGTGG - Intergenic
1078129068 11:8596950-8596972 AAGAATTAATAGAAGAAAGGAGG + Intergenic
1078407647 11:11084907-11084929 AAGAGCCAAGAGATGAATGCTGG - Intergenic
1078472267 11:11600148-11600170 ATCAGTTAAGAGAAGAAAGGAGG + Intronic
1078834038 11:15008644-15008666 AAGAGTAAAGAAAAGAATTTTGG - Intronic
1079093739 11:17497833-17497855 AAGAATCAAGAGAATTCTGGGGG - Intronic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1080626234 11:34033221-34033243 AATAGTGATGAGAAGAAAGGAGG - Intergenic
1080905483 11:36540732-36540754 AAGAACAAAGAGAAGATTGGAGG - Intronic
1081015111 11:37867808-37867830 AAGAGTCGAGAGAAATGTGGAGG - Intergenic
1081284720 11:41253817-41253839 AAGAGTCAAAAGACTAATGACGG + Intronic
1081831156 11:46116429-46116451 AAGAGTCTATAGAAGAATCAGGG + Intronic
1083529569 11:63407356-63407378 AAGAGTTAGGTGAAGACTGGTGG - Intronic
1085952641 11:81350971-81350993 AAAAGCAAAGAAAAGAATGGTGG - Intergenic
1086027139 11:82307708-82307730 AACAGTTAAGAGAAAAATGCAGG + Intergenic
1086471858 11:87122053-87122075 AACAGCGAAGAGAAGATTGGAGG + Intronic
1086564340 11:88208402-88208424 TAGAGTAAAGAGTAGAATAGTGG - Intergenic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1086844191 11:91728184-91728206 GAGATTCAAGACTAGAATGGGGG - Intergenic
1087094499 11:94306438-94306460 AAGTGTCTAGGGAAGAAAGGTGG - Intronic
1087389453 11:97515184-97515206 GTGAATCAAGAGAAGACTGGAGG - Intergenic
1087601614 11:100323640-100323662 AAGAGTGATGAAAAGAAGGGGGG - Intronic
1087693967 11:101354327-101354349 AAGAGACAGGAGAAGACTAGAGG + Intergenic
1088234570 11:107708628-107708650 AAAAGTCAGGACAAAAATGGTGG - Intronic
1088405881 11:109478275-109478297 AAAAGTAGAGAGAAGAATAGTGG + Intergenic
1088612543 11:111591643-111591665 TAGAGTCAAGAGAAGTTTGGTGG - Intergenic
1088732063 11:112692394-112692416 GAGAGGCAAGAGAAGACTGAAGG - Intergenic
1088936237 11:114402998-114403020 AAGAGATAAGAGAATAATGAAGG - Intronic
1089124726 11:116168735-116168757 AAGAGACAAAAGCAGAGTGGGGG - Intergenic
1089899560 11:121966592-121966614 AAGAGTCAAATGAAGAGTAGAGG - Intergenic
1090425014 11:126601689-126601711 AGGATGCATGAGAAGAATGGAGG - Intronic
1090565470 11:127987040-127987062 ATGAATCAAGAGAATAAAGGAGG + Intergenic
1091022873 11:132116518-132116540 AAGAGTCCAGAGAAGAGGTGCGG - Intronic
1091239071 11:134040383-134040405 AAGAGGAAAGATAAGAATGAGGG + Intergenic
1091676404 12:2493728-2493750 AAGAGGCAAGAAAAGGATGAGGG - Intronic
1091843508 12:3637211-3637233 AAGAACCAAGAGAAAAATGATGG + Intronic
1092288265 12:7142522-7142544 AAGAGTCAAAACAAGGAGGGAGG - Intronic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1092547227 12:9462577-9462599 AAAAGTCTAGAGACGAATGTTGG + Intergenic
1092803365 12:12194885-12194907 AAAAGTAAAGAGTAGAATAGGGG - Intronic
1093514815 12:19973269-19973291 AAGAGTCAGAAGAAAAATGGTGG - Intergenic
1093734606 12:22606348-22606370 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1094020692 12:25910837-25910859 AAGAGTCAACAGAAGAACAATGG - Intergenic
1094318282 12:29156037-29156059 AAAAGTAGAGAGAAGAATGGTGG + Intronic
1095554107 12:43480763-43480785 ATAAGTAGAGAGAAGAATGGTGG + Intronic
1095713508 12:45315954-45315976 ATGAGTCCAGGGAAGAAAGGTGG - Intronic
1095853480 12:46835516-46835538 AAAAATAAAGAGAAGATTGGTGG - Intergenic
1096435169 12:51583913-51583935 AAAAGTAAAGAGTAAAATGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097006826 12:55925827-55925849 AAGAGTAAAGAGAAGTATACTGG + Intronic
1097506034 12:60471789-60471811 TAGAGTCCAGGGTAGAATGGTGG - Intergenic
1097509950 12:60526990-60527012 AGAAGTGAAGAGTAGAATGGTGG - Intergenic
1097971990 12:65643174-65643196 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1098194053 12:67980833-67980855 AAGAGGCACCAGAATAATGGTGG + Intergenic
1098729765 12:74019481-74019503 AAAAGTTGAGAGTAGAATGGTGG + Intergenic
1099547473 12:84002975-84002997 AACAGTCAAAAGAAAACTGGAGG - Intergenic
1100588104 12:95998116-95998138 ATGAGTCAAGGAATGAATGGGGG - Intergenic
1100705007 12:97191086-97191108 ATGAAGCAAGAGAAGAAAGGTGG + Intergenic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100858122 12:98776413-98776435 AAGGCTCAAGAGAAGAACTGGGG + Intronic
1101268827 12:103121315-103121337 AAGAGACAAGAGAAGAGCTGAGG + Intergenic
1101280123 12:103244969-103244991 AAGAGTCAACAGAAGCAAAGGGG + Intronic
1101308900 12:103558186-103558208 AAGGGTCAAGAGTGGAATCGGGG - Intergenic
1101797986 12:107993871-107993893 AAAAGTAAAGAGTAGAATAGTGG - Intergenic
1102708544 12:114905017-114905039 AATAGTCATGAGATGCATGGTGG - Intergenic
1102807546 12:115795180-115795202 AAGAGTCAAGATGAGATAGGTGG - Intergenic
1102828212 12:115969005-115969027 AAGAGTTGGGAGAGGAATGGAGG + Exonic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1104325708 12:127795118-127795140 AAGAGTGAAGAGAAAAAAGCAGG - Intergenic
1105359133 13:19690792-19690814 AAGAGGAAAGAGAAGAAAGTTGG - Intronic
1105774939 13:23650129-23650151 AAGAGCTAGGGGAAGAATGGAGG - Intronic
1106061173 13:26293951-26293973 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1106384243 13:29268555-29268577 AGAAGACAAGAGAAGAATGAGGG - Intronic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1106525318 13:30535470-30535492 AATGGTAAAGAGAAGCATGGAGG - Intronic
1106571024 13:30927981-30928003 AAGAGTTTAGAGAAGAATTAGGG + Intergenic
1107779403 13:43881628-43881650 AACAGTCAACAAAAGAAAGGAGG - Intronic
1108248136 13:48538058-48538080 AGAAGTTAAGAGCAGAATGGTGG + Intergenic
1108428022 13:50324922-50324944 ATGAGTGAAAATAAGAATGGAGG - Intronic
1108467056 13:50726918-50726940 AAGAGGCAAGAGGAAAGTGGGGG + Intronic
1108744031 13:53371391-53371413 AAGAATTAAGAGAAAAAAGGGGG - Intergenic
1108954236 13:56132472-56132494 AGAAGGCAAGAGTAGAATGGTGG + Intergenic
1108982150 13:56528536-56528558 AAGAGTTCAGGGAAGAGTGGAGG - Intergenic
1109364118 13:61333509-61333531 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1109638997 13:65162488-65162510 AGGAGTGCAGAGTAGAATGGTGG - Intergenic
1110624682 13:77639582-77639604 AAGAGTGAAGATGTGAATGGAGG - Intronic
1110724326 13:78802125-78802147 AAAAGTAGAGAGCAGAATGGTGG - Intergenic
1110776784 13:79416924-79416946 AAGAGAAAAGGAAAGAATGGTGG - Intergenic
1110932719 13:81242805-81242827 GAGTGTCAAGAGAAGAAGGGAGG - Intergenic
1110954587 13:81538189-81538211 AAAAGTTGAGAGGAGAATGGTGG + Intergenic
1110984091 13:81941091-81941113 AAAAGTAAAGACTAGAATGGTGG - Intergenic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1112226211 13:97543273-97543295 AAGAGTCAAGTGGAGAAGGTCGG + Intergenic
1112675952 13:101701895-101701917 AATATTCTAGAGATGAATGGTGG + Intronic
1112804212 13:103145075-103145097 AAGAATCAAGAAAAGCATGTGGG + Intergenic
1113014766 13:105816455-105816477 AAGCGTCAAGAGAAGAAGATGGG + Intergenic
1113070199 13:106412783-106412805 AGGAATGAAGAGAAGAATGAGGG - Intergenic
1113278978 13:108767658-108767680 AAGAGTGAAGGGAAGAAGGCAGG + Intronic
1113282313 13:108802271-108802293 AAAAGTAGAGAGAAGAATGATGG - Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1114062687 14:19034241-19034263 AGAAGTTAAGAGTAGAATGGTGG - Intergenic
1114099573 14:19365756-19365778 AGAAGTTAAGAGTAGAATGGTGG + Intergenic
1114184884 14:20393502-20393524 AAGAGACAAGACAGGCATGGTGG + Intronic
1114241289 14:20870805-20870827 AAGAGAGAAAAGAAGAAAGGAGG + Intergenic
1114404226 14:22440136-22440158 TAGGGTCAAGAGAAGAGTGAAGG - Intergenic
1114632428 14:24167800-24167822 AAGACTGAAGGGAAGAAGGGAGG - Intergenic
1115485854 14:33910710-33910732 ATGAGTCAAGTGAAGTATAGAGG + Intergenic
1115632312 14:35257288-35257310 AAAAGTCTGGAGATGAATGGTGG - Intronic
1115749793 14:36477655-36477677 AGGAGTCAAGAGGGAAATGGGGG + Intronic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1116910492 14:50458288-50458310 AAGAGTCAAGGGAAGCAAGATGG - Intronic
1117099486 14:52331919-52331941 AAGAGACAAGAGAGAAATGATGG - Intergenic
1117441966 14:55768459-55768481 TTGAATGAAGAGAAGAATGGTGG + Intergenic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117765334 14:59076115-59076137 AAGAGTCAAGTGAAGAATGCTGG + Intergenic
1117817330 14:59611522-59611544 ACCAGTCAGGAGAAGAAAGGAGG - Intronic
1117927751 14:60802082-60802104 AGAAGTAAAGAGTAGAATGGTGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1120701470 14:87703756-87703778 CTGAGCCATGAGAAGAATGGTGG + Intergenic
1120766665 14:88333671-88333693 AAGAGGTATGAGAAGGATGGAGG - Intergenic
1120968081 14:90185025-90185047 CAGAGGCCAGAGTAGAATGGAGG + Exonic
1122193917 14:100070408-100070430 CAGAGTCAAGGGTAGAATCGAGG + Intronic
1122395040 14:101420227-101420249 AAGGCTGAAGAGAAGACTGGAGG + Intergenic
1122430709 14:101639448-101639470 AAGAGCTAAGAGAAGAAATGGGG + Intergenic
1123508205 15:20967447-20967469 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123565425 15:21541194-21541216 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123601689 15:21978483-21978505 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123779548 15:23612735-23612757 AGAAGTAGAGAGAAGAATGGTGG + Intronic
1123935406 15:25191690-25191712 AAGACACAAGGGGAGAATGGGGG - Intergenic
1123947467 15:25245779-25245801 AAGACACAAGGGAGGAATGGGGG - Intergenic
1123948683 15:25251149-25251171 AAGACACAAGGGGAGAATGGGGG - Intergenic
1124790672 15:32723287-32723309 AAGAATCAAGAGCAGTCTGGGGG + Intronic
1126558834 15:50021262-50021284 GAGAGACAAGAGCAGAATGACGG - Intronic
1126576787 15:50205198-50205220 AAGTGTCAAGAAAGAAATGGTGG - Intronic
1126799996 15:52289617-52289639 ACCAGTCAAGAGAGGATTGGTGG - Intronic
1127024339 15:54786340-54786362 AAAAGACAAGAGATAAATGGTGG + Intergenic
1127029911 15:54850708-54850730 AAGAATCAAAAGATCAATGGTGG + Intergenic
1127217026 15:56834079-56834101 AGGAGTCCAGAGAAGACTTGAGG - Intronic
1127804191 15:62503668-62503690 AAGAGCCAAGAGAGGAAATGGGG - Intronic
1128929935 15:71695163-71695185 AAAAGTCAAGAGAGGAAGAGAGG - Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130773017 15:86944068-86944090 AAGAGTCAGGTGAAGAATGAAGG + Intronic
1131651074 15:94400243-94400265 ATGAATCAGGAGAATAATGGGGG - Intronic
1131864594 15:96694084-96694106 AAGACTGAAGAGGAGATTGGTGG - Intergenic
1132077356 15:98833184-98833206 AAGAGTCAATACAAGAATCTTGG - Intronic
1202973797 15_KI270727v1_random:268284-268306 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133559055 16:6933134-6933156 AAGCGTCTACAGATGAATGGAGG - Intronic
1134196289 16:12161769-12161791 CACAGGCAAGAGAAGAAGGGCGG - Intronic
1135286124 16:21194722-21194744 AGGTGTCAAGAGTAGAATGATGG - Intergenic
1136089901 16:27911231-27911253 ATGAGGCTAGAGAAGAAAGGAGG - Intronic
1136362731 16:29791161-29791183 AATAAGCAAGAGAAGAGTGGCGG + Intronic
1137033822 16:35551343-35551365 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1138229014 16:55324325-55324347 AAGAGACAGGAGAAAAGTGGGGG - Exonic
1138567647 16:57845293-57845315 AAGAGTCCAGGGAGGGATGGTGG - Intronic
1138586727 16:57975581-57975603 AAGAGTCAAGAAATAAATTGGGG + Intergenic
1139190919 16:64861941-64861963 AAGAGGCAAGGGAAGGAAGGAGG + Intergenic
1139608678 16:68039098-68039120 AAGACTTAAGAGGAGATTGGCGG + Intronic
1139872409 16:70118182-70118204 TAGGGTCAAGAGAAGAGAGGAGG + Intronic
1140363362 16:74363113-74363135 TAGGGTCAAGAGAAGAGAGGAGG - Intergenic
1141455398 16:84137974-84137996 AAGATTCAAGACAAGAATCAGGG - Intronic
1141735391 16:85848672-85848694 AAGAGTCTGGAGATGGATGGTGG + Intergenic
1141824834 16:86471727-86471749 AAGAGACAAGGGGAGAAGGGAGG - Intergenic
1143933186 17:10452863-10452885 AAGAGCCAAGAGAAAACTGGAGG - Exonic
1144189716 17:12833395-12833417 AAGAGTCAAGAGAGTCAGGGAGG - Intronic
1145295064 17:21583462-21583484 AAGAGTCTAATGAAGAATGAAGG - Intergenic
1145368776 17:22289712-22289734 AAGAGTCTAATGAAGAATGAAGG + Intergenic
1147679832 17:42234932-42234954 AAGAATGAAGAGAAGAATCTAGG + Intronic
1148993848 17:51690398-51690420 AGAAGTGAAGAGAAGAATGTTGG - Intronic
1150638897 17:66936220-66936242 TAGAGACAAAAGTAGAATGGTGG - Intergenic
1150869355 17:68888548-68888570 TAGAGGCAAGAGAAGAATTGAGG + Intronic
1151097739 17:71518509-71518531 AAGAGTCAATAGCAGAATTCTGG + Intergenic
1151252510 17:72847466-72847488 AAGGGTCAAGAGGGGAATGAGGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1153066815 18:1055083-1055105 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
1154469521 18:14685322-14685344 AGGAGTAGAGAGTAGAATGGTGG - Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1155885159 18:31198733-31198755 AAGACTCAAGACAGGAAAGGAGG - Intergenic
1156038560 18:32794123-32794145 AAGAGTCAAGATAATAGGGGAGG - Intergenic
1157133605 18:45032513-45032535 ATGAGTGAAGAGATGAATGAAGG - Intronic
1157684028 18:49628684-49628706 AGGAGGTAAGAGAAGAATGGTGG + Intergenic
1159072764 18:63644621-63644643 AAAATCCAAGAAAAGAATGGTGG - Intronic
1159074209 18:63662258-63662280 AAAATCCAAGAAAAGAATGGTGG - Intronic
1162614547 19:11787044-11787066 GAGAGTAAAGAGTAGAATTGAGG - Intergenic
1162640357 19:12003673-12003695 AAGAGTAAAGACAAGAGTGTTGG + Intergenic
1163045543 19:14638813-14638835 AGGAGTAGAGAGTAGAATGGAGG - Intronic
1163113938 19:15178178-15178200 AAGAGTCAAGGGGAGAGAGGGGG + Intronic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163751525 19:19081136-19081158 AAGAATAAAGAAAAGAAAGGAGG + Intronic
1164946896 19:32303014-32303036 AAGAGTCAAGAGAAAATAGATGG - Intergenic
1165265899 19:34663860-34663882 AAGAGACAGGAGAGGACTGGGGG + Intronic
1166165291 19:40983630-40983652 AAAAGCAAAGAGTAGAATGGGGG + Intergenic
1166450711 19:42898160-42898182 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166462611 19:43002502-43002524 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166963060 19:46511207-46511229 GAGAGTCAAAAGAACAATGCAGG + Intronic
1168053883 19:53850152-53850174 AGAAGTAAAGAGTAGAATGGGGG + Intergenic
1168570229 19:57460913-57460935 AAAAGTAGAGAGTAGAATGGTGG - Intronic
925684447 2:6457066-6457088 CAGAGGCAAGAGAAGAATCTGGG + Intergenic
925965898 2:9065665-9065687 CAGAGTTGAGGGAAGAATGGTGG - Intergenic
926294076 2:11554912-11554934 AACAGTCAAGACAGCAATGGGGG - Intronic
926805895 2:16710725-16710747 AAGAGTAGAAAGAAGAATGATGG + Intergenic
926808896 2:16739041-16739063 AGGAATCAAGAGAAGAGGGGAGG + Intergenic
927179317 2:20433290-20433312 AGGAGTCAAGAGAGAAGTGGAGG - Intergenic
927310412 2:21624731-21624753 AGGAGCCAAGAGCAGAATGTTGG - Intergenic
927381776 2:22487700-22487722 ATCAGTCAAGAGAGGAATGCAGG + Intergenic
927405084 2:22757611-22757633 AAGAGACAAGGGAGGAAAGGTGG - Intergenic
928269297 2:29841990-29842012 AGGAGTGAAGAGGAGGATGGAGG - Intronic
928289873 2:30027732-30027754 CAAAATCATGAGAAGAATGGGGG + Intergenic
928835825 2:35543454-35543476 TAGAAGCAAGAGTAGAATGGTGG + Intergenic
929271487 2:39977126-39977148 GAGAGTGAAGAGGAGACTGGTGG + Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
929981005 2:46680242-46680264 AAGAGGAAAGAGAAGATTTGGGG + Intergenic
930339358 2:50093252-50093274 AAGGGTCATGAGAAATATGGTGG + Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930695841 2:54411068-54411090 AAGTGTCAGGGCAAGAATGGGGG - Intergenic
931846145 2:66206113-66206135 AAAATTCAAGAGAAGAAAAGAGG - Intergenic
933832893 2:86224890-86224912 CAGTGTCAGGGGAAGAATGGAGG + Intronic
935033957 2:99349972-99349994 AAAAGTAAAGAGTAGAATAGTGG - Intronic
935391465 2:102557761-102557783 AAGAGACAAGAAAAAAATGTGGG + Intergenic
936032825 2:109085972-109085994 AACAGTTAAGAGATGGATGGTGG - Intergenic
936606255 2:113958117-113958139 AAGAGTAAAGACAAGAGTGTTGG + Exonic
936919264 2:117670874-117670896 ATGAGGCAAGAAAAGAATAGGGG + Intergenic
937103988 2:119293638-119293660 AATAGTCCAGGTAAGAATGGTGG + Intergenic
937467345 2:122146044-122146066 AAAAGTCATTAGAGGAATGGAGG + Intergenic
937724459 2:125145489-125145511 AATAATTAAGGGAAGAATGGTGG - Intergenic
937817853 2:126273413-126273435 ATGAGTCTAGAGACAAATGGGGG - Intergenic
938196026 2:129329199-129329221 AGGAGCAAAGAGTAGAATGGTGG + Intergenic
938480045 2:131654330-131654352 AGAAGTTAAGAGTAGAATGGTGG - Intergenic
938981375 2:136530479-136530501 AAGGGACTAGAGAGGAATGGAGG - Intergenic
939061033 2:137421507-137421529 AAGAGACAAGAGGGGCATGGGGG + Intronic
939122141 2:138129954-138129976 AAGAACAAAGAGAAGATTGGGGG + Intergenic
939192110 2:138929225-138929247 AAGAAACAAAAGAAGAAGGGAGG - Intergenic
939630579 2:144523068-144523090 AAAAGTCGAGAGAGGACTGGGGG + Intronic
940190828 2:151038427-151038449 ATGAGTCAAGAGAGGAGGGGAGG - Intronic
940483964 2:154274539-154274561 AAGTGCCAAGAGCAGCATGGGGG - Intronic
941180682 2:162255406-162255428 AAGAGTTAAGAGAAAAATAAGGG + Intergenic
941388930 2:164887910-164887932 TAAAGTCAAGAGTAGAATGGTGG - Intergenic
941651644 2:168098684-168098706 AGGAGACAAGAAAAGAAAGGAGG - Intronic
941797424 2:169615497-169615519 AGAAGTACAGAGAAGAATGGTGG - Intronic
941921231 2:170852953-170852975 AAGAGCCAAGAGAAGAAACCAGG - Intronic
942108488 2:172656907-172656929 AAGACTCAAGACAAGTGTGGGGG + Intergenic
942693397 2:178611587-178611609 AAGCCTCCAGAGAAAAATGGTGG - Exonic
944267681 2:197746915-197746937 AAAAGCAGAGAGAAGAATGGTGG + Intronic
946135102 2:217639580-217639602 AAGAGAGAAGAAAAGAAGGGAGG + Intronic
946230100 2:218285997-218286019 TGGAGGCTAGAGAAGAATGGAGG + Intronic
946549910 2:220789949-220789971 CAGAGTGAAGAGAAGAATTTTGG - Intergenic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946857969 2:223972052-223972074 AAAGGTAAAGTGAAGAATGGCGG - Intergenic
946906737 2:224424595-224424617 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
947139727 2:227009744-227009766 AAGAGAGAAGAGAAGAGGGGAGG + Intronic
947251272 2:228107269-228107291 AAAAGTAGAGAGTAGAATGGTGG - Intronic
947330736 2:229026782-229026804 AAGAATCAAGAGTAGAATGCTGG + Intronic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
948982573 2:241501831-241501853 AAGAAACCAGAGAAGAATTGAGG - Intronic
1170052817 20:12165340-12165362 AAGAGTCATGAGATAATTGGTGG - Intergenic
1170433616 20:16300466-16300488 AAGAGGGAAGAGAAGAACAGTGG - Intronic
1171336981 20:24393759-24393781 GAGAGGCAAGAGCAGAAGGGAGG + Intergenic
1171563487 20:26153466-26153488 ATGAGTAAATAGAAGAATCGAGG - Intergenic
1171568999 20:26227952-26227974 AAGAGAAAAGGGATGAATGGTGG - Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1172376637 20:34447450-34447472 AAGAGTCACAACAACAATGGTGG - Intronic
1173082932 20:39886977-39886999 TGGAGTCCAGAGAAGAAAGGAGG - Intergenic
1173260774 20:41432998-41433020 AAGACTCAACAGCAGAATGGTGG + Intronic
1173611987 20:44375609-44375631 CAGAGCCAAGACTAGAATGGTGG + Intronic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1173833888 20:46112594-46112616 AAGAGTCAGCAGATGAAAGGTGG + Intergenic
1173956499 20:47037100-47037122 AAGTGCCAAGAGAAGCAAGGAGG + Intronic
1173965976 20:47113257-47113279 AGGATCCAGGAGAAGAATGGAGG + Intronic
1174619880 20:51865833-51865855 AGGATTCAAAAGAAGAATAGGGG - Intergenic
1175203711 20:57294991-57295013 AAGAGCAAAGAGCAGATTGGGGG + Intergenic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1176444514 21:6808531-6808553 AGAAGTTAAGAGTAGAATGGTGG - Intergenic
1176804982 21:13472328-13472350 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
1176822679 21:13673569-13673591 AGAAGTTAAGAGTAGAATGGTGG - Intergenic
1176981630 21:15387586-15387608 AAAAGCCAAGAGTAGAATGATGG + Intergenic
1177240371 21:18447692-18447714 AAGAGACAAGTGCAGAATGAAGG - Intronic
1178335476 21:31738747-31738769 AAGAGTCAAGAAGAAAATAGAGG - Intergenic
1178389298 21:32185324-32185346 AAGAGGGAAGAGAAAAATGCTGG - Intergenic
1178614086 21:34115226-34115248 AAGAACTCAGAGAAGAATGGAGG - Intronic
1178639966 21:34337782-34337804 AAGACACCAGAGAAGAAGGGAGG + Intergenic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1180281929 22:10707695-10707717 AAGAGAAAAGGGATGAATGGTGG + Intergenic
1180589273 22:16922306-16922328 AAGAGTCAAGGGAAGGGTGAAGG + Intergenic
1181963789 22:26642538-26642560 GAGAGAGAAGAGAAAAATGGAGG + Intergenic
1182059937 22:27389559-27389581 AAGAGTGCACAGAAGAAAGGAGG + Intergenic
1184312148 22:43653082-43653104 AAGAGTGAAGAGAGGCATGTGGG + Intronic
1184931547 22:47684986-47685008 AAAAGTCTGGAGATGAATGGTGG - Intergenic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1185123812 22:48992659-48992681 AGAAGTAGAGAGAAGAATGGTGG + Intergenic
1185269096 22:49920289-49920311 AAGAATCATGAGAAGAAGAGGGG - Intronic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
949089865 3:14352-14374 AAGAATGAAGAAAAGAAGGGAGG + Intergenic
950090709 3:10292244-10292266 AGGAGTCAAGAGATCCATGGGGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
952599229 3:35058762-35058784 AAAAGTGAAGAGATGAATGCTGG + Intergenic
953165957 3:40465159-40465181 AACAATCAAGAGACGAATAGAGG + Intergenic
953456836 3:43049031-43049053 AAGAGTCAGGGGAAGGATGGAGG + Intronic
954629650 3:52040916-52040938 AAGGGACAAGGGAGGAATGGGGG - Intergenic
955061457 3:55495367-55495389 AGAAGCCAAGAGTAGAATGGTGG - Intergenic
955446221 3:59013255-59013277 AAGAAAGAAGAGAAAAATGGAGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955819396 3:62880174-62880196 AAGAAACAAGAGAAGACTGATGG - Intergenic
956248401 3:67210194-67210216 TAGAGTGAAGAGAAGAATTTAGG - Intergenic
956901201 3:73717690-73717712 AAGAGGACAGAGAACAATGGAGG - Intergenic
957029543 3:75224080-75224102 AAGAATGAAGAAAAGAAGGGAGG + Intergenic
957109849 3:75940378-75940400 AAGAGAAAAGGGATGAATGGTGG + Intronic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
957530264 3:81431716-81431738 AAGATTCAAGCAAAAAATGGTGG - Intergenic
957650636 3:82998089-82998111 AAGAAAAAAGAGTAGAATGGTGG + Intergenic
957658545 3:83115757-83115779 AAGAGTCATGAAAAGCATGCTGG - Intergenic
958130813 3:89419658-89419680 GACAGTTAAGAGAAGAATTGTGG + Intronic
958700281 3:97580479-97580501 GAGAGTCAAGAGAAAAAGTGAGG - Intronic
959205193 3:103298298-103298320 AAGGGGCAAGAGAGGAAGGGAGG - Intergenic
959258140 3:104040866-104040888 AAGAGACAAGAGGAAAAGGGAGG - Intergenic
959404352 3:105941996-105942018 AAGAAGAAAGGGAAGAATGGAGG - Intergenic
960407199 3:117276415-117276437 CACATTCAAGAGAGGAATGGAGG - Intergenic
960440677 3:117683826-117683848 AAGAGTCTAGTTAAGGATGGGGG + Intergenic
961004559 3:123396157-123396179 AAAAGAAAAGAGAAGAAGGGAGG + Intronic
961658356 3:128455455-128455477 AAGAGTCCTGAGACGGATGGTGG + Intergenic
962508784 3:136077305-136077327 AAGAATCCAGAAAAGAAAGGTGG + Intronic
962779689 3:138700585-138700607 AAGAAAAAAGAGATGAATGGGGG + Intronic
962894395 3:139700840-139700862 AAGAGAGAACAGAAGATTGGTGG + Intergenic
963423037 3:145086682-145086704 AATACTCATAAGAAGAATGGAGG - Intergenic
963562983 3:146890250-146890272 AAGAGAGAAGACAAGCATGGAGG + Intergenic
963579194 3:147102796-147102818 AGGAGCAAAGAGTAGAATGGTGG - Intergenic
966070104 3:175865626-175865648 AAGTGTCAAGAAAATAATGAAGG - Intergenic
967226915 3:187300935-187300957 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
967790545 3:193544108-193544130 AAGAGTCCAGAGAAGTAAGAGGG - Intronic
969499272 4:7543280-7543302 ATGAGTCAACAGATGAACGGAGG - Intronic
970252582 4:14131525-14131547 AAAAGTCAAGTGGAGATTGGTGG + Intergenic
970537750 4:17046612-17046634 ATGAATCATGAGAAGAAGGGTGG + Intergenic
971104113 4:23502657-23502679 AAGTAACAAGAGAACAATGGAGG + Intergenic
971135185 4:23860771-23860793 AAGAGTCAAAAGATGAATGCAGG + Intronic
971311567 4:25529917-25529939 AAGAGAGGAGAGAAGAAGGGAGG + Intergenic
971597068 4:28543751-28543773 CAGAGTCAGGAAAAGAAAGGAGG - Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972693209 4:41419802-41419824 AAGAGGGAAGGGAAGAAAGGAGG - Intronic
972844998 4:42976997-42977019 AAAAGTAGAGAGTAGAATGGTGG - Intronic
972957651 4:44412363-44412385 AAGAGTCAACAAAAGATTGGTGG - Intronic
973083885 4:46030104-46030126 AAGATTGAAGAGATGAATGGGGG - Intergenic
973272560 4:48276466-48276488 AAGTGTCAATGGAAGAATAGTGG + Intergenic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
974120573 4:57632926-57632948 AAGAGTCAAGAGAGGAAACCAGG - Intergenic
974223365 4:59005142-59005164 AAGAGGCAAGAGAGGAATAAAGG + Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
975208581 4:71672503-71672525 AAGACTCGGGAGAAGCATGGAGG + Intergenic
975294567 4:72718111-72718133 AAAAGTAGAGAGCAGAATGGTGG + Intergenic
975574868 4:75852650-75852672 TAGAGGCAAAAGAAGAATTGGGG + Intergenic
976573556 4:86641131-86641153 AAGAGTCAGGAGAAGAACTTGGG - Intronic
976634063 4:87269819-87269841 AGGAGTTATGAGAGGAATGGTGG + Intergenic
976886364 4:89989647-89989669 TAAAGTCAACAGAAGAATGTTGG + Intergenic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978157593 4:105507637-105507659 AAGAGAGATGAGAAGACTGGCGG + Intergenic
979003211 4:115253937-115253959 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
979148542 4:117277988-117278010 GAAAGGCAACAGAAGAATGGAGG + Intergenic
979405010 4:120299155-120299177 AAGAGGAAGGAGAAGAAAGGGGG - Intergenic
979768238 4:124489540-124489562 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
980499631 4:133631733-133631755 AAGAGTTACAAGAAGAATGAGGG - Intergenic
980577293 4:134699483-134699505 AGGAATCCAGAGAAGAAGGGAGG + Intergenic
980636277 4:135508247-135508269 AAAAGTCAATAGAATAAAGGTGG - Intergenic
980872881 4:138630234-138630256 AATTGTCAAGAGGACAATGGAGG - Intergenic
981844592 4:149153312-149153334 AATACTCAAGAGAAATATGGTGG + Intergenic
982079557 4:151775523-151775545 AAGAACAAAGGGAAGAATGGTGG + Intergenic
982081602 4:151795666-151795688 AAAAGTCAAGAGAATAATTATGG - Intergenic
982379941 4:154739715-154739737 CAGAGTCAGGAGCAGAATGCAGG - Intronic
982656858 4:158160916-158160938 AAAAGTAGAGAGTAGAATGGTGG + Intronic
982822568 4:159961332-159961354 AGAAGTAAAGAGAAGAATAGTGG - Intergenic
982893212 4:160882462-160882484 AGAAGTCAAGAGTAGAATAGTGG + Intergenic
983907840 4:173203530-173203552 AAGAGAGAAGAGCAGAATGAAGG - Intronic
984323187 4:178220451-178220473 AGGAAAGAAGAGAAGAATGGAGG + Intergenic
984745137 4:183207968-183207990 AAGATCCAAGAAAACAATGGAGG + Exonic
985966821 5:3344022-3344044 AAGGGACAAAAGAAGAATGAGGG - Intergenic
986304724 5:6506719-6506741 AGGGGGCAAGAGAAGAAAGGAGG + Intergenic
986365420 5:7023735-7023757 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986526859 5:8688405-8688427 AAGAGGCAGGAGAAGCAAGGGGG + Intergenic
986830826 5:11575837-11575859 AAGAATCACAAGGAGAATGGTGG - Intronic
987323066 5:16788130-16788152 AGGAGGCAAGAGAAGAATCAGGG + Intronic
987445380 5:18011264-18011286 TATAGTGAAGAGAAGAAGGGTGG - Intergenic
987759067 5:22135640-22135662 AAGAATGAAGAGAAGGCTGGAGG + Intronic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988001204 5:25351467-25351489 AAGACAAAAGAGAAGACTGGAGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988476113 5:31587538-31587560 AAGAGTGAAGTTAAGAGTGGAGG + Intergenic
988848167 5:35151238-35151260 ACGAGGCAAGAGTAGTATGGAGG - Intronic
989803242 5:45571474-45571496 AATAGACAAGCTAAGAATGGTGG + Intronic
991041349 5:62178798-62178820 AAGACTGAAGAGAGGAGTGGAGG + Intergenic
991571300 5:68056013-68056035 AATAGTCAATTGAAAAATGGAGG - Intergenic
991893779 5:71369086-71369108 AAGAATGAAGAGAAGGCTGGAGG + Intergenic
991906303 5:71515717-71515739 GAAAGTCTAGAGATGAATGGTGG - Intronic
992127646 5:73658233-73658255 TAGAGTAAAGAGAAGAAATGGGG - Intronic
992446165 5:76835872-76835894 AAAAGTCAAAAAAAGAAGGGTGG - Intergenic
992540559 5:77760094-77760116 AAGAGTTGAGAGAAGAGGGGAGG + Intronic
993259199 5:85637693-85637715 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
993334596 5:86642471-86642493 AAGAGTCACTAGAAGTAAGGAGG - Intergenic
993683238 5:90906002-90906024 ATATATCAAGAGAAGAATGGAGG - Intronic
994064611 5:95524107-95524129 ACAAGTCAAGATAAGAATGTAGG + Intronic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994186587 5:96822081-96822103 AGCAGTGAAGAGAGGAATGGCGG - Intronic
994475151 5:100258537-100258559 AAGAATGGAGAGAAGAATGGAGG - Intergenic
995308916 5:110688998-110689020 AAGGGTCAAAGGAAAAATGGGGG - Intronic
995484442 5:112625888-112625910 GAGAGTGAAGAGATGAATAGAGG - Intergenic
995547468 5:113247410-113247432 AAGAGTAAAGAGAACAAAGCAGG + Intronic
995670281 5:114595110-114595132 AAAGGTCAAGAGAAGCATCGTGG - Intergenic
995877574 5:116806665-116806687 AGGAGTACAGAGAAGAGTGGTGG - Intergenic
996058665 5:119008645-119008667 AAGAGCCAAGGGCAGAAGGGAGG + Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996652344 5:125894812-125894834 AAGAACAAAGAGAAGATTGGAGG - Intergenic
997654474 5:135545040-135545062 AGGAGTAAAGAGAAGACAGGAGG + Intergenic
997950364 5:138237872-138237894 AAGAGACAAGACTAGAATAGGGG - Intergenic
998265923 5:140667754-140667776 AAGAGGCAAGATCAAAATGGAGG - Intronic
998377442 5:141700565-141700587 AAGAGGCAAGAGATGAAAGATGG + Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999442699 5:151614976-151614998 AGGAGTCAAGAGAAGGCAGGTGG - Intergenic
999513202 5:152274260-152274282 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
999625382 5:153515436-153515458 AGAAGTAAAGAGTAGAATGGTGG + Intronic
999779530 5:154837865-154837887 GAGAGCCAAGAGGAGAAGGGAGG + Intronic
1000161011 5:158597809-158597831 AAGAACAGAGAGAAGAATGGTGG + Intergenic
1000446764 5:161331691-161331713 AAGAATCGTGAGAAGACTGGAGG + Intronic
1001488821 5:172141073-172141095 TAGAATCAAGAGTGGAATGGTGG + Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1001945856 5:175777436-175777458 AAGAGTGAGGTGAAGAAGGGAGG - Intergenic
1002147926 5:177200505-177200527 AAGAGTCTGGAGATGAATAGTGG - Intronic
1002453781 5:179334042-179334064 AAGACACAGGAGGAGAATGGAGG + Intronic
1002885716 6:1292164-1292186 CAGAGTTAAGAGCAGAATAGGGG - Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004916929 6:20340933-20340955 AGGAAGCAAGAGAGGAATGGAGG + Intergenic
1004939676 6:20542578-20542600 AATAGTTAAGAAAAAAATGGGGG - Intronic
1005250069 6:23935252-23935274 TGAAGTCAAGAGTAGAATGGTGG + Intergenic
1005360332 6:25025082-25025104 AAGAGTCAAGAAAAAAAGAGAGG + Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1006630491 6:35426969-35426991 AAGTCTCAAGAGAAGGAGGGGGG + Exonic
1006655375 6:35587843-35587865 CAGAGTCAAGAGAACAATCTGGG + Intronic
1007019252 6:38503180-38503202 AGGAGACATGAGAGGAATGGAGG - Intronic
1007362062 6:41365738-41365760 TAGAAGCAAGAGGAGAATGGTGG - Intergenic
1007855714 6:44854295-44854317 AAGAGTCCATAGAAGGATGATGG - Intronic
1008105567 6:47437687-47437709 AGTAGTCAAAAGAAGAATGAAGG - Intergenic
1009445023 6:63732526-63732548 TAAAGTCAAGAGAAAAATTGAGG + Intronic
1009839053 6:69043213-69043235 AAGAGACAAGAAAAGAAGGAAGG + Intronic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011575006 6:88787677-88787699 AGGAGTGAAGAAAAGATTGGAGG + Intronic
1011668720 6:89661460-89661482 GACAGTGAAGACAAGAATGGTGG - Exonic
1011819601 6:91235755-91235777 AAGAGCCTAGAGAAGGATGGAGG - Intergenic
1011823976 6:91284972-91284994 AAGGGTCAAGAGAAGCCTGAAGG + Intergenic
1012733329 6:102909113-102909135 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1012780554 6:103551521-103551543 AAGAGTCTGGAGATAAATGGTGG + Intergenic
1012882998 6:104814117-104814139 AAGAATAAAGAAAAGAAAGGGGG + Intronic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012962911 6:105641570-105641592 AAGAGTGAACAGAAAAATGATGG - Intergenic
1013061396 6:106637559-106637581 AAGAGGGAAGAGAAGCATTGAGG + Intronic
1013191601 6:107808391-107808413 AGGAGTCAAGTGAAGAGTGCTGG + Intronic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013373770 6:109494393-109494415 AAAAGTTAAGAGAAGAAAGAAGG + Intronic
1013619143 6:111872423-111872445 AAGAGTGAAGGGGAGGATGGGGG + Intronic
1013641826 6:112091041-112091063 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1013950511 6:115775612-115775634 AAAAGTCGAGAGTAGAATTGTGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015199910 6:130567754-130567776 AAGAGGCAAGAAAAAAATAGAGG + Intergenic
1016271831 6:142299422-142299444 AAGAGTAGAGAGTACAATGGTGG + Intergenic
1016298035 6:142597079-142597101 AAGAGTCAAAAGAAGAGAAGAGG + Intergenic
1017728959 6:157297520-157297542 AAGTGGGAAGAGAAGAGTGGTGG - Intronic
1018229687 6:161663764-161663786 AGGAGGCAAGGGAAGAATGGAGG - Intronic
1018230956 6:161674880-161674902 AAGAGTCAAGGGTAGGAAGGAGG + Intronic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019776160 7:2913167-2913189 AAGAGGGAAGAGAAGAGGGGAGG + Intronic
1020837617 7:13173668-13173690 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1021627717 7:22610743-22610765 ATGATTGAAGAGAAGAAGGGAGG + Intronic
1021794107 7:24236273-24236295 AAGAGTAAAGTTAAGAGTGGAGG + Intergenic
1021928278 7:25554113-25554135 ATGAGTCAAGAGGAGGATGGGGG - Intergenic
1023567028 7:41533464-41533486 AGGAGTCAAGAGAAGATTTGGGG + Intergenic
1024577979 7:50780411-50780433 AAGGGTCAAGGGCAGAATGAGGG - Intronic
1024816254 7:53275361-53275383 AAGGCTGAAGAGAAGAATGTTGG - Intergenic
1025966341 7:66275680-66275702 TAGAAGCAAGAGTAGAATGGTGG + Intronic
1027221387 7:76216443-76216465 AAAAGTCAAGATAAGACTGCAGG - Intronic
1027433437 7:78138132-78138154 AAAAGTCAAGAGATGCAGGGTGG - Intronic
1027506930 7:79027513-79027535 AGAAGCCAAGAGTAGAATGGTGG + Intronic
1028290088 7:89055251-89055273 GAAAGTGAAGACAAGAATGGTGG + Intronic
1028556447 7:92131097-92131119 AAGAGGAAAGTGAAGAATGAAGG + Intronic
1029430573 7:100526580-100526602 AGGAGAGAAGAGAAAAATGGAGG - Intergenic
1029923170 7:104287615-104287637 AAAAGAAAAGAGAAGAAGGGAGG - Intergenic
1029926540 7:104325366-104325388 AAGCAACAAAAGAAGAATGGGGG - Intergenic
1031144624 7:117984219-117984241 AAGAGTTAGGTGAAGAATGAAGG + Intergenic
1031436657 7:121740083-121740105 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1031955052 7:127934497-127934519 AAGAGGCAAGAGAATAGTAGAGG + Intronic
1032600457 7:133288242-133288264 AAGGGAGAGGAGAAGAATGGAGG - Intronic
1032928880 7:136642020-136642042 AAGAGACAAGAGAAAACTAGGGG - Intergenic
1032961678 7:137042473-137042495 AAGAGGGAAGAGAGAAATGGGGG - Intergenic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033301785 7:140192624-140192646 AAGAAGGAAGAGAAGAAAGGAGG + Intergenic
1033471860 7:141657327-141657349 GACTGTCAAGTGAAGAATGGTGG - Exonic
1033869862 7:145738775-145738797 AGGAGTAGAGAGCAGAATGGTGG - Intergenic
1035002557 7:155625337-155625359 AAGAGTCCAGTGCAGACTGGGGG + Intronic
1037083330 8:14814618-14814640 AAGAGTTCAGAGAAGATGGGAGG + Intronic
1037853701 8:22354081-22354103 AAGAGGCTACTGAAGAATGGTGG - Intronic
1038127493 8:24691000-24691022 AAGATTGAAAAGAAGAATGATGG + Intergenic
1038204890 8:25457584-25457606 AAGAGTACAGAGAAGTTTGGCGG + Intronic
1038996988 8:32934490-32934512 AAGAGTCAATAGTGGAATGCTGG + Intergenic
1039159882 8:34605670-34605692 AAGAAGCAAGAGCAGAATGGTGG - Intergenic
1041572922 8:59358123-59358145 AAGAGTTAGGAGAAAAGTGGTGG - Intergenic
1043150365 8:76706867-76706889 AAGAGTTAAGGGATCAATGGCGG + Intronic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1044298384 8:90554969-90554991 AAGAGTTAAGTGAAGAAATGGGG - Intergenic
1044381292 8:91536976-91536998 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045153284 8:99434710-99434732 GAAAATTAAGAGAAGAATGGGGG + Intronic
1045782074 8:105878221-105878243 AAGGTTCAAGAGAAGAAAAGAGG + Intergenic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1046125767 8:109905306-109905328 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046816595 8:118591014-118591036 TAGGCTCAAGAGCAGAATGGAGG + Intronic
1046933175 8:119861729-119861751 AAAAGGAAAGAGAAGAAGGGAGG + Intergenic
1047153957 8:122296264-122296286 AAGAAGAAAGGGAAGAATGGAGG + Intergenic
1047264059 8:123289013-123289035 AAGAGTTGTGAGGAGAATGGGGG + Intergenic
1047342366 8:123994428-123994450 AAGAGTCCAGAGAAGGAGTGGGG + Intronic
1047374412 8:124282384-124282406 GAGAGGCAAGAGAAGACAGGAGG + Intergenic
1047826582 8:128582362-128582384 AACGGTGAAGAGAATAATGGTGG - Intergenic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1047895469 8:129361679-129361701 CAGAGTTAAGAGAAAAATGTTGG + Intergenic
1048434916 8:134407228-134407250 ATGAGTCAAGAAAAGAAGGTAGG - Intergenic
1049015437 8:139916707-139916729 AAGAGTCTATAAAAAAATGGTGG + Intronic
1050136244 9:2468390-2468412 AAGAGTCCAGAGACATATGGAGG + Intergenic
1050354038 9:4766253-4766275 AAGAGTCAAGAAAAAAACTGAGG + Intergenic
1050375625 9:4969915-4969937 AAACCTCAAGAGAATAATGGAGG - Intergenic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1051894319 9:21972035-21972057 AGCAGTAAAGAGTAGAATGGTGG - Intronic
1052115554 9:24645151-24645173 TACAGTCCAGAAAAGAATGGGGG - Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1052606245 9:30706048-30706070 AGAAGTCAAAAGAAGAATGAGGG + Intergenic
1052777286 9:32744904-32744926 TAGAGTAGAGAGCAGAATGGTGG + Intergenic
1052993982 9:34539887-34539909 AAGAGACAAGAGTTGAAAGGTGG + Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055132399 9:72791215-72791237 CAGAGACAAGAGAATAATGCAGG - Intronic
1055324753 9:75117868-75117890 GAGGGTCAAGAGGAGAATGAAGG - Intronic
1055442350 9:76348827-76348849 AGAAGTAAAGAGTAGAATGGTGG - Intronic
1055964686 9:81854292-81854314 AAGAGTCAAGAGGAGAAATGAGG - Intergenic
1056105610 9:83343535-83343557 AAGAGGCACGAGAAGAAATGAGG + Intronic
1056568807 9:87798273-87798295 AAGAGTCAAGAGGAAATGGGAGG - Intergenic
1056624347 9:88241854-88241876 AGGAGATAAGAGAAGAAAGGAGG + Intergenic
1056686885 9:88773902-88773924 AAGGGTCATGTGAAGAATTGAGG - Intergenic
1056847374 9:90052421-90052443 AAAAGTGAAGAGAAGAAGGCAGG - Intergenic
1057058200 9:91980189-91980211 AAGAGTCTGGAGATCAATGGTGG + Intergenic
1057871560 9:98722058-98722080 CAGTGTCAAGTGAAGACTGGGGG - Intergenic
1058825494 9:108772675-108772697 AAGAGACAAGCGAAGAAGGGAGG + Intergenic
1058849638 9:108998359-108998381 AAGAGTTAGGAGAACAATGAAGG - Intronic
1059873549 9:118605450-118605472 AAAAGCGAAGAGTAGAATGGTGG + Intergenic
1059979953 9:119760621-119760643 AAGAGTGAAGAGAAGAAATTGGG - Intergenic
1060894479 9:127208968-127208990 AAGACTCACGAGAAGAAAAGTGG + Intronic
1060937717 9:127525281-127525303 AAGAGGCAAGAGAGGAACAGAGG + Intronic
1061266644 9:129509554-129509576 ACAATTCAAGAGAAAAATGGGGG + Intergenic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1203524684 Un_GL000213v1:75996-76018 AGAAGTTAAGAGTAGAATGGTGG + Intergenic
1185490967 X:516663-516685 AAGAGCCAGGAGTAGAATGTAGG - Intergenic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1186640826 X:11453619-11453641 AAGAGTCAAGAGAATACTATTGG - Intronic
1186900979 X:14055686-14055708 AAGAGTAAAGAGTAGAACAGTGG - Intergenic
1187756938 X:22538635-22538657 AGGAGTCAGGAGAAGAATAAAGG - Intergenic
1188049503 X:25467203-25467225 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1188536320 X:31200991-31201013 ATCAGTCAAGATATGAATGGTGG - Intronic
1188557284 X:31427060-31427082 AAGAGTCAAAAGAGGAATTAAGG + Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1189299552 X:39942619-39942641 AATAGTCATGAAAACAATGGAGG + Intergenic
1189407433 X:40737330-40737352 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189561752 X:42198196-42198218 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189851822 X:45185559-45185581 AGGAGGCAAGAGAAGACTAGGGG - Intronic
1190505588 X:51122734-51122756 AGAAGTGGAGAGAAGAATGGTGG - Intergenic
1191719752 X:64219602-64219624 AATAATCGAGAGAAGAATGATGG - Intergenic
1192474608 X:71429390-71429412 AATAGTCAAGTGGAAAATGGTGG + Intronic
1192488915 X:71556652-71556674 AAGAGTCAAGATCAGAACTGAGG - Intronic
1192972401 X:76247130-76247152 AAAAGTTGAGAGTAGAATGGTGG - Intergenic
1193258658 X:79379852-79379874 AAGAGCGAAGAGAAGCAGGGTGG + Intergenic
1193997533 X:88384764-88384786 AACAGTTCAGAGAAGAACGGAGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194671885 X:96743649-96743671 AGAAGTCGAGAGTAGAATGGTGG + Intronic
1196644981 X:118108422-118108444 AAAAGGCAAGTGAAGAAAGGGGG - Intronic
1196698581 X:118641092-118641114 AAGACTTAAGACAAGAAAGGGGG - Intronic
1196762847 X:119215389-119215411 AAGAGGCAAGAATAGAATGGTGG + Intergenic
1197020668 X:121684036-121684058 AAGAAACAAAAGAAGAAAGGAGG - Intergenic
1197264775 X:124357169-124357191 ACAAGCCAAGAGTAGAATGGTGG - Intronic
1197383785 X:125779225-125779247 AAGAGTGGAGAGTAGGATGGTGG - Intergenic
1199007117 X:142713485-142713507 AGAAGTAAAGAGAAGAATAGTGG + Intergenic
1199054984 X:143283241-143283263 AAAAGCCAAGAGTAGAATGATGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1201253902 Y:12088419-12088441 AAGGGGAGAGAGAAGAATGGAGG - Intergenic
1201475491 Y:14376851-14376873 AAGGAGGAAGAGAAGAATGGAGG + Intergenic
1201646152 Y:16234717-16234739 TAGATTCAAGAGAATAATGTTGG - Intergenic
1201656661 Y:16350600-16350622 TAGATTCAAGAGAATAATGTTGG + Intergenic