ID: 977968058

View in Genome Browser
Species Human (GRCh38)
Location 4:103178495-103178517
Sequence CTCTTGAATTGGAGCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977968058 Original CRISPR CTCTTGAATTGGAGCAAACA TGG (reversed) Intronic
901539888 1:9909336-9909358 CTCTTGATTTGCGGCCAACACGG + Intronic
906132512 1:43469049-43469071 CTCTGAGATTGGAGCAGACAAGG + Intergenic
909973918 1:82023164-82023186 ATCTTAAATTGGAGCAAATATGG + Intergenic
911085778 1:93976443-93976465 CTCTTGCTTTGGAGGAAGCATGG + Intergenic
911286410 1:95999079-95999101 CTGGTGAATTGTATCAAACAAGG + Intergenic
916637912 1:166693607-166693629 CACTTGAATTCCAGCAAACTGGG - Intergenic
918184780 1:182116982-182117004 CTCTTCAATTGGAAAGAACAAGG - Intergenic
920957238 1:210630740-210630762 CTCTGGAATTGTATCACACAGGG - Intronic
922329148 1:224558390-224558412 CTCTTGAATCTGAGCAAGCCTGG - Intronic
922950153 1:229552490-229552512 CTACTGAATTGCAGCAAAGATGG + Intronic
1064923780 10:20547958-20547980 CTTTTGAATTGGAGCAAGTATGG + Intergenic
1065928854 10:30460843-30460865 GTCTTAATTTAGAGCAAACATGG - Exonic
1067764302 10:49073561-49073583 CCATTGAATTGGAGGAAACAAGG - Intronic
1067796369 10:49325017-49325039 CTCTTGGATTGGGGAAAATAAGG + Exonic
1070238374 10:74654498-74654520 TACTTGAATTGGATCAAACCAGG - Intronic
1072564972 10:96609866-96609888 GTCTGGAATTGGAGGAAAGAGGG + Exonic
1080054810 11:27895502-27895524 CTCTTGCATTGGTCCAAGCATGG - Intergenic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1083892889 11:65605641-65605663 CTCTAGAATGAGAGCAACCAGGG + Intronic
1084764669 11:71300458-71300480 CTCTTGGCTTGTAGCAATCAGGG - Intergenic
1089518096 11:119046397-119046419 CTGGTGAGTTGGAGCAACCATGG - Exonic
1091250541 11:134140566-134140588 CTCTTGAATTAGAGCTTGCAGGG + Intronic
1093454234 12:19349165-19349187 CTGCTGTACTGGAGCAAACATGG + Intronic
1097757366 12:63421678-63421700 TTCTTGAATTGCAGAAATCAAGG + Intergenic
1101099079 12:101373746-101373768 CACTTGGTTTGGAGCAAAAAAGG + Exonic
1102770217 12:115469630-115469652 CACTAGAATCTGAGCAAACATGG + Intergenic
1104483103 12:129125915-129125937 CTCTTGAAACAGAGTAAACAGGG + Intronic
1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG + Intronic
1106744796 13:32689850-32689872 CTCTTAAATTGGATGAAATATGG + Intronic
1108585960 13:51869980-51870002 CTCTTGAATAGGATCAGTCATGG - Intergenic
1111533034 13:89564956-89564978 CTCTTGAATAGCAACAATCAAGG + Intergenic
1112468143 13:99663232-99663254 GTCTGAAACTGGAGCAAACAGGG + Intronic
1114824555 14:26061323-26061345 CTTTTGAATTGGAGAAATTAAGG - Intergenic
1115553128 14:34522431-34522453 CTCTTCAAATGGACAAAACAAGG - Intronic
1116691491 14:48112374-48112396 CTCTGGAATGGGAGCAAGGAGGG - Intergenic
1120074304 14:80138275-80138297 CTCTTGAAGTAGAGCAATTAGGG + Intergenic
1120668219 14:87332942-87332964 CACTTGAATTGGGGCCAAAAAGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123864377 15:24502729-24502751 CGCTTGAATTTAATCAAACATGG + Intergenic
1131439184 15:92445874-92445896 CACATGAATGGGAGGAAACAAGG - Intronic
1131604584 15:93887889-93887911 CTCTTGAAATTGACCATACAAGG - Intergenic
1137904295 16:52304199-52304221 CTCTTGGGTTGTAGCAAACATGG - Intergenic
1139610791 16:68056310-68056332 GTATTGAATTAGAGCAAAGAAGG - Intronic
1148529501 17:48376007-48376029 CTTGTGTATTGGAGAAAACAAGG + Intronic
1159706471 18:71695652-71695674 CTGTTCAAGTGGAGCACACAGGG - Intergenic
1166642638 19:44507097-44507119 CTCTTCAATAGAAGCAAGCAAGG - Intronic
925106512 2:1296900-1296922 ATCTGGAATTGAAGCAAAAAGGG - Intronic
929309844 2:40409966-40409988 CTAGTGAATAGGAGCAACCACGG + Intronic
933917221 2:87007762-87007784 CTCTTGAAGAGTAGAAAACATGG + Intronic
934005775 2:87762152-87762174 CTCTTGAAGAGTAGAAAACATGG - Intronic
934048863 2:88193376-88193398 CCCTGGAGTTGGAGCAAAAATGG - Intergenic
938805602 2:134804571-134804593 CTGCTGAATAGGAGCAAAGAAGG + Intergenic
939663009 2:144913854-144913876 CTCCTGATTTGGGGCACACATGG - Intergenic
939917333 2:148063952-148063974 ATCTTCAATCTGAGCAAACAGGG - Intronic
944101564 2:196032672-196032694 CTAATGAATTTGATCAAACAAGG + Intronic
946906901 2:224426372-224426394 CACTAGAATGGGAGAAAACAAGG - Intergenic
946999901 2:225442167-225442189 CTCCTGTATTGGAACAAATACGG - Intronic
947098940 2:226598017-226598039 CTCTTGAATTAGAGCAAAGATGG - Intergenic
947263090 2:228246515-228246537 CTCTTCATTTGGTGAAAACATGG + Intergenic
947265151 2:228270581-228270603 CTCTCTAATTGGAGCCCACATGG - Intergenic
948983069 2:241504825-241504847 CACCAGAAATGGAGCAAACAGGG - Intronic
1170108758 20:12782102-12782124 CACTTGAAATGTAGCTAACAAGG - Intergenic
1170430931 20:16275833-16275855 GACTTGAATTGCATCAAACAGGG + Intronic
1171078522 20:22154088-22154110 CTCTTGCATTGGATTAAGCAGGG - Intergenic
1173054824 20:39601405-39601427 CTCTTGGGTTGAAGCAAATATGG + Intergenic
1177895150 21:26847780-26847802 CCCTTAAATTGGGGCAAAAAGGG + Intergenic
1183317935 22:37147187-37147209 CTCTTTAAATGCAGCAATCAGGG + Intronic
1183764374 22:39857588-39857610 CTCTGAAACTGGAGCAAACTTGG - Intronic
949284995 3:2391917-2391939 CTCTTTAAATGGGGCAAATATGG + Intronic
952585938 3:34892396-34892418 CACTTGGTTTGCAGCAAACAGGG + Intergenic
952843610 3:37668499-37668521 CTCTCAACTTGGAGCAGACAGGG + Intronic
956152255 3:66256110-66256132 CTCTTGAATTGAAAAATACAAGG + Intronic
957484613 3:80842353-80842375 ATTTTAAATTGGAGCAAAAAGGG - Intergenic
958108145 3:89104445-89104467 CTCTTGAATCAGAGCAATCTAGG - Intergenic
959509377 3:107192681-107192703 CTCTTGAAATGGCCCTAACATGG - Intergenic
964007099 3:151844262-151844284 CTCTTAACTTGAAGGAAACATGG - Intergenic
966663184 3:182438500-182438522 CTCTTGATGTGGAGAATACAAGG + Intergenic
966830771 3:184006468-184006490 CTCTTGACTTGGAAAACACAAGG + Intronic
973694875 4:53480992-53481014 CTCTTAATTTGGACTAAACAAGG + Intronic
974313521 4:60245741-60245763 CTTATGAATTGGACCAACCAGGG - Intergenic
975921298 4:79393077-79393099 CTAATCAATTGGAGCAAAGATGG + Intergenic
976738787 4:88337183-88337205 CAATTGAAATGGAGCAAACTAGG - Intergenic
977968058 4:103178495-103178517 CTCTTGAATTGGAGCAAACATGG - Intronic
981358020 4:143814091-143814113 CTGTGGAACTGGAGTAAACATGG - Intergenic
981369265 4:143940202-143940224 CTGTGGAACTGGAGTAAACATGG - Intergenic
982775046 4:159432588-159432610 CTACTCAATGGGAGCAAACACGG - Intergenic
982812043 4:159838034-159838056 TCATTGAATTGGGGCAAACATGG + Intergenic
986914013 5:12594010-12594032 CTCTTTAAATGAAGTAAACATGG + Intergenic
990333806 5:54752919-54752941 TTCTTGCATTAGATCAAACAAGG + Intergenic
990707461 5:58545828-58545850 CTCTTTAATTAGAGCACACTTGG + Intronic
994214410 5:97121606-97121628 CTATTAAAATGGAGCAAGCAGGG - Intronic
997588526 5:135058935-135058957 CTGTTGAATGGGAGCATGCAAGG + Intronic
999410806 5:151348090-151348112 TTCTTAAATTGGAACAAAAAAGG + Intergenic
999787788 5:154907787-154907809 GTATTGAATTGGAGAAAAAACGG - Exonic
1001175026 5:169460434-169460456 CTGTTCAATTGGATCAAACTTGG + Intergenic
1004104275 6:12650959-12650981 CTCTAGAATTGGAGGCAAAATGG + Intergenic
1007814989 6:44515483-44515505 CTCTTGAAGTGGGGTAAAGATGG - Intergenic
1009496226 6:64351300-64351322 CTATTTAAATGTAGCAAACATGG + Intronic
1014729224 6:125011456-125011478 CTCTGGAATTGGAGCATGCTGGG - Intronic
1016092073 6:139992356-139992378 ATAATGAATTGGAGCATACATGG + Intergenic
1017993387 6:159509781-159509803 CTTTTGAGTTGGAGCGAGCAAGG + Intergenic
1020131831 7:5563078-5563100 CTCTTGGCTTGGAGCAGGCAGGG + Intronic
1022828120 7:34037481-34037503 ATCTTGAAATATAGCAAACATGG + Intronic
1030920750 7:115382856-115382878 CTCTTGGATAGGAGCCGACATGG + Intergenic
1038977187 8:32712930-32712952 CTCTAGAATTGGATCATCCATGG + Intronic
1039391921 8:37188162-37188184 CTCTGGCATTGGAGCACAAAAGG + Intergenic
1041699983 8:60777934-60777956 CTCATTTATTAGAGCAAACATGG - Intronic
1042043606 8:64622803-64622825 CTTTGAAATTGGAGAAAACATGG + Intronic
1043816023 8:84802555-84802577 CTGTTGGATTAGAGCATACAGGG - Intronic
1044986887 8:97763715-97763737 CTCTTGAATTGCAGCCAAGGAGG - Intergenic
1045058371 8:98389691-98389713 CTCTTGAATTGGAACTAAGCAGG - Intergenic
1048900423 8:139032111-139032133 GTCTTGAAGTAGAACAAACATGG - Intergenic
1052050285 9:23839451-23839473 CTCTTGAATTGCACCAAAAATGG - Intergenic
1052914512 9:33914313-33914335 CTCCTGTATTTTAGCAAACATGG - Intronic
1056509056 9:87285439-87285461 CTCCTGGGCTGGAGCAAACACGG - Intergenic
1058702972 9:107615918-107615940 CAATTGAATTGGAGAATACATGG - Intergenic
1061401038 9:130368499-130368521 CCCTGAAATTGGAGCAAATACGG + Intronic
1188155316 X:26734816-26734838 ATCTTGAATTGAAGCAAGAAAGG + Intergenic
1188970849 X:36613460-36613482 CTCTTGGATTTGACAAAACAGGG + Intergenic
1192672382 X:73159208-73159230 CCCTTGTATTGGAGCAGAAAGGG + Intergenic
1194172207 X:90601438-90601460 GTCTGGAGTTGGAGCAAAGAGGG - Intergenic
1196980885 X:121212572-121212594 CTCTTCAAATGGAAAAAACAAGG - Intergenic
1197890297 X:131263537-131263559 AACTTGAAGTTGAGCAAACATGG + Intergenic
1197965773 X:132060060-132060082 CTGTTGAATTGAATCTAACATGG - Intergenic
1200518439 Y:4179175-4179197 GTCTGGAGTTGGAGCAAAGAGGG - Intergenic