ID: 977978559

View in Genome Browser
Species Human (GRCh38)
Location 4:103296063-103296085
Sequence CTAGGGTTTTTATGGTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 44, 1: 99, 2: 75, 3: 99, 4: 397}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977978559_977978562 -10 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978562 4:103296076-103296098 AAAACCCTAGAAGAAAACCTAGG 0: 14240
1: 7168
2: 4548
3: 3654
4: 4847
977978559_977978572 25 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978559_977978568 16 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978568 4:103296102-103296124 TACCATTCAGGACATAGGCATGG 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
977978559_977978565 4 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978565 4:103296090-103296112 AAACCTAGGCAATACCATTCAGG 0: 8733
1: 11767
2: 5172
3: 2689
4: 1745
977978559_977978570 19 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978570 4:103296105-103296127 CATTCAGGACATAGGCATGGTGG No data
977978559_977978567 11 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978567 4:103296097-103296119 GGCAATACCATTCAGGACATAGG 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
977978559_977978571 20 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978571 4:103296106-103296128 ATTCAGGACATAGGCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977978559 Original CRISPR CTAGGGTTTTTATGGTTTTA GGG (reversed) Intergenic
900747149 1:4368224-4368246 TTAGGGTCTTTTTGCTTTTATGG - Intergenic
900841827 1:5055734-5055756 CTAGAATTTTTATGGTTTCAGGG - Intergenic
901458558 1:9377747-9377769 CAAGGGTTTTTTTGTTTTTTTGG + Intergenic
904363817 1:29997641-29997663 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
904765363 1:32841836-32841858 CTAGAGGTTTTATAGCTTTAGGG + Intronic
905121238 1:35683487-35683509 GTAGGGTCTTAATGGTTTAAAGG + Intergenic
905330223 1:37189553-37189575 TTAGGGATTTTCTTGTTTTATGG + Intergenic
906583967 1:46959732-46959754 CTAGTAGTTTTATGGTTTCAGGG - Intergenic
907065283 1:51475792-51475814 CTAGGGTTTTTATGGGTTTTAGG + Intronic
908197812 1:61762416-61762438 CTTGGGTTTTTCTAGTTTTGGGG + Intronic
908732848 1:67244424-67244446 CTAGGTTTTTTATGGTTATTAGG + Intronic
909230311 1:73080732-73080754 CCAGGGTTTTTATAGTTTTAGGG + Intergenic
909324845 1:74337463-74337485 CTAGGGTTTTTATGGTTATTAGG + Intronic
909396547 1:75176785-75176807 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
909403760 1:75263009-75263031 CTAGGGTTTTTTATGGTTTAAGG - Intronic
909689450 1:78390765-78390787 CTAGGTATTTTATTGTTTTGTGG + Intronic
909722644 1:78794562-78794584 CCAGGTTTTTTATTTTTTTAAGG - Intergenic
909819430 1:80042612-80042634 TTAGGGATTTTATGGGTTCATGG - Intergenic
909822008 1:80077370-80077392 CTAGGGTTTTTATGATTTTATGG - Intergenic
910136941 1:83983493-83983515 CTAGGATTTTTATAGTTTGAGGG - Intronic
910524817 1:88165615-88165637 CTAGGGTTTTTATGGTTTCATGG - Intergenic
910805279 1:91183802-91183824 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
911508917 1:98787572-98787594 CTGGGGTTTTTATGGTTGGTAGG - Intergenic
911927407 1:103852132-103852154 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
912103418 1:106240459-106240481 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
912306902 1:108577410-108577432 CTAGGGTTTTTATGGTTTTTAGG + Intronic
912614292 1:111082072-111082094 CTAGGGTTTCTATAGTTTTAGGG + Intergenic
912676375 1:111685152-111685174 CTCGGGTTTTTATGGTTTTAGGG - Intronic
912768404 1:112438064-112438086 CCAGGGTTTTTATAGTTTTTGGG + Intronic
913177728 1:116290381-116290403 GTAGTGTTTTTATTGTTTTCTGG + Intergenic
913480612 1:119285688-119285710 CTAGGGTTTTAAGGGGATTATGG - Intergenic
913546650 1:119875449-119875471 CTAGAGTTTTTATAATTTTAGGG - Intergenic
914995947 1:152543483-152543505 CTAGGGTCTTGAAGATTTTATGG - Intronic
915682205 1:157592124-157592146 CTAGAGTTTTTATGGTTTTTAGG - Intronic
915767443 1:158378048-158378070 CTAGTATTTTTATAGTTTTGGGG - Intergenic
916823928 1:168426529-168426551 CTAGTGATTTGATTGTTTTATGG - Intergenic
916829811 1:168479379-168479401 CTAGGGTTTTTATAGTTTGGGGG - Intergenic
916884118 1:169050588-169050610 CTAGGGTTTATATCTTTTCAAGG - Intergenic
917054310 1:170962856-170962878 CTAGGATTTTTATAGTTTTGGGG - Intronic
917102083 1:171456313-171456335 CAAGATTTTTCATGGTTTTAGGG - Intergenic
917298156 1:173543884-173543906 CTGGGTTTTTTATGGTTTTTAGG - Intronic
917880416 1:179330155-179330177 CTAGGGTTTTTATGGTAAGTTGG + Intronic
919146343 1:193640531-193640553 CTAGGGTTTTTATGTTTTTTAGG + Intergenic
919186505 1:194158125-194158147 CTAGGGCTTTTATGATTTTTAGG + Intergenic
919268898 1:195312819-195312841 CCAGGGTTTTCATAGTTTTGGGG + Intergenic
919272626 1:195369325-195369347 TTATGGTTTTTATTGTTTAAGGG + Intergenic
919383046 1:196882138-196882160 CTAGGGTTTTTATGGTTTTTAGG - Intronic
919391153 1:196987474-196987496 CTAGGGTTTTTATGGTTTTTAGG + Intronic
919608351 1:199714304-199714326 CCAGGGCTTTTATTGTTTTTGGG - Intergenic
919627047 1:199921602-199921624 CTAGAGTTTTTATAGTTTGGGGG + Intergenic
921241964 1:213193927-213193949 CTACGGTTATTATTGTTTTGGGG + Intronic
922118681 1:222640637-222640659 CTAGAAGTTTTATGGTTTTAGGG - Intronic
923232092 1:231996454-231996476 CTAGGGTTTTTTTGGTTTTAAGG + Intronic
923864591 1:237926575-237926597 CTCTGGTTTTTTTGGTATTAGGG + Intergenic
924206860 1:241720907-241720929 CTAGGTCTTTTATGGTTTTGGGG + Intronic
924868193 1:248009535-248009557 CTGGGCTTTTTTTGGTTATAAGG - Intronic
1064279126 10:13935094-13935116 CTTGGATTTTCATGGTTTTATGG - Intronic
1064514199 10:16128305-16128327 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
1064619720 10:17202501-17202523 CTTGGGATTATATGGTTTTAGGG + Intergenic
1065074890 10:22067448-22067470 CTAGGATTTTTACAGTTTTCAGG + Intergenic
1065739725 10:28786264-28786286 CTTGGGTTTGTGTTGTTTTATGG + Intergenic
1067529393 10:47059512-47059534 GTAGGGTTGTTGAGGTTTTAAGG + Intergenic
1068205935 10:53853297-53853319 CTAGGCATTTTATGGTTTGGAGG - Intronic
1068553365 10:58430838-58430860 CTAGGTATTTTATGGTTTTTTGG + Intergenic
1068771985 10:60832008-60832030 CTCGGGTTTTTACAGTTTTATGG - Intergenic
1068814117 10:61290734-61290756 CCAGGGTTTTTACAGTTTTGGGG + Intergenic
1069072908 10:64008054-64008076 CTAAGATTTTTATAGTTTTTGGG + Intergenic
1069089528 10:64182218-64182240 CTTGGGTTTTTTTGTTTTTTTGG - Intergenic
1069234138 10:66048817-66048839 CCAGGGTTTTTATAATTTTTGGG - Intronic
1069296910 10:66857644-66857666 CTAGGTATTTTATTGTTTTGTGG + Intronic
1069316053 10:67103979-67104001 CAAGGGTATTTATGTTTTGAAGG - Intronic
1069387684 10:67899266-67899288 CTGGGGTTTTTGTGGATTTTGGG - Intronic
1070974402 10:80594760-80594782 CCAGTGTTTTCATTGTTTTATGG + Intronic
1071689280 10:87798232-87798254 CTAGGGTTTTTATGTGTGGATGG - Intronic
1071959182 10:90792930-90792952 TTAGGAGTTTTATAGTTTTAGGG - Intronic
1072373397 10:94789457-94789479 CTAGGGTTTTTATGGTTTTAGGG + Intronic
1072796320 10:98357567-98357589 CTGGGGATTTCATGGTTCTAGGG - Intergenic
1073733601 10:106320429-106320451 CCAGGGTTTTTATGGGTCTTAGG - Intergenic
1075176284 10:120164391-120164413 ATAATGTTTTTATGGTTTTGAGG + Intergenic
1075570001 10:123534547-123534569 CCAGGATTTTTATAGTTTGAGGG - Intergenic
1075758281 10:124833886-124833908 ACAGGGTTTTTAAAGTTTTAAGG + Intronic
1075860406 10:125670705-125670727 CTAGGGTTTTTATAGTTTTGGGG + Intronic
1077697558 11:4408195-4408217 TTAGGGTTTTTAATGTTTTTAGG - Intergenic
1077708089 11:4507714-4507736 CCAGGGTTTTTATAGTTTTGGGG - Intergenic
1077812475 11:5652277-5652299 CTAGGGTTTTTATAAGTTTTAGG + Intergenic
1077984403 11:7336452-7336474 CCAGGATTTTTATAGTTTTGGGG + Intronic
1078049234 11:7947250-7947272 TTAGGGTCCCTATGGTTTTAGGG - Intergenic
1079081833 11:17418977-17418999 ATAGGGTTTATAGGGTTGTAAGG - Intronic
1079271416 11:18989825-18989847 CTAGGGTTTTTAATGGTTTTAGG + Intergenic
1079538645 11:21545521-21545543 GTAGTGTGGTTATGGTTTTAGGG + Intronic
1079763712 11:24362554-24362576 CTATGGTTTTTATTGTGTTGAGG - Intergenic
1079777272 11:24547602-24547624 CTAGGGTTTTTATTAGTTTTAGG - Intronic
1079824056 11:25168143-25168165 CTAGGGTTTTTAATGGTTTTAGG + Intergenic
1079920963 11:26434025-26434047 CTGGGGTTTTTTTGGTTGTTAGG + Intronic
1081240977 11:40706322-40706344 CTAGGGTTTTTATGGTTTTAGGG + Intronic
1082196813 11:49316386-49316408 CTAGTGTATTAATGGTTTTGAGG + Intergenic
1082680944 11:56169194-56169216 CTAGTATTTTTATAGTTTTTTGG - Intergenic
1082712287 11:56567538-56567560 CATGTGTTTTAATGGTTTTAGGG + Intergenic
1083499675 11:63092721-63092743 ACAGAGTTTTTATGGTTTTGGGG - Intronic
1083577617 11:63803647-63803669 CTTGTGTTTTTTTGGTTTTGGGG + Intergenic
1085444968 11:76594838-76594860 CTAGAGTTTTTATAGTTTTGGGG - Intergenic
1086119283 11:83288673-83288695 CTAGAGTTTTTATAGTTTGAGGG + Intergenic
1086299903 11:85415983-85416005 CTATGGTTTTTACGGTTTTTAGG + Intronic
1086328707 11:85731611-85731633 CTAGGGTTTTTATGGTTTTAGGG - Intronic
1086386050 11:86309683-86309705 TTAGGGTTTTTATGGTTTTAGGG + Intronic
1086824546 11:91479699-91479721 CTAGCATTTTTATAGTTATATGG - Intergenic
1087484555 11:98745570-98745592 CTAGGGTTTTTATGGTTTGGGGG - Intergenic
1087641203 11:100755817-100755839 ATAGGTTTTTCATGGTGTTAAGG + Intronic
1087733198 11:101801744-101801766 CTAGGGTTTTTATGGTTTTATGG - Intronic
1087902111 11:103652333-103652355 CTAGGGTTTTTATGGATAATTGG - Intergenic
1088084090 11:105957222-105957244 CTAGGGTTTTTATGGCTTTTAGG + Intronic
1088509077 11:110555946-110555968 CTAGGGTTTTTATGATTTTTAGG + Intergenic
1088694168 11:112352368-112352390 CTAGGATTTTTATGATTCTAGGG + Intergenic
1088698300 11:112389246-112389268 CTTGGGTTTTGTTGTTTTTATGG + Intergenic
1089934689 11:122351918-122351940 CTAGGGTTTTTATAGTTTTAAGG - Intergenic
1090451905 11:126813791-126813813 CTAGGGTTTTTCTAGTTTCGGGG - Intronic
1090559629 11:127917735-127917757 TTAGGGTTTTTATGAATTTGGGG - Intergenic
1090984381 11:131752769-131752791 CTAGGGTTTTTGTGGTTTTAGGG - Intronic
1092072747 12:5646167-5646189 CTTTGGTTTTGGTGGTTTTATGG - Intronic
1092363958 12:7861623-7861645 GTATGGTTTGTATGGTTTTCGGG - Intronic
1092696047 12:11172282-11172304 TTATGGTTTTTATTGTTTAAGGG + Intergenic
1093329726 12:17820799-17820821 ATAAGATTTTTATGGATTTATGG + Intergenic
1093340030 12:17962690-17962712 ATAGGGTTTTTATAGTTGTGGGG + Intergenic
1093522950 12:20071784-20071806 CTGGGGTTTTTATAGTTTTGGGG - Intergenic
1093597250 12:20976848-20976870 CTAGGGTTTTTACAGTTTTATGG + Intergenic
1093716569 12:22389934-22389956 CTAGGAATTTTGTAGTTTTATGG - Intronic
1093790098 12:23238691-23238713 ATTGTGATTTTATGGTTTTAAGG - Intergenic
1094036496 12:26077374-26077396 CTAGGGTTTTTATGGTTTTTAGG + Intronic
1094149681 12:27269232-27269254 CTAGGGTTTTTATGGTTTTTAGG + Intronic
1094171851 12:27501690-27501712 CCAGGGATTTTATTGTTTCATGG + Intronic
1094264259 12:28538097-28538119 TTAGGGTTTTTTTATTTTTAGGG + Intronic
1094310821 12:29080439-29080461 CTAGAATTTTTATAGTTTTTAGG - Intergenic
1094789971 12:33901495-33901517 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1095652990 12:44635395-44635417 CTAGGGTTTTTATGGCTTTAGGG + Intronic
1095786571 12:46116085-46116107 CAAGAATTTTTATGGTTTTTAGG - Intergenic
1096468779 12:51863774-51863796 TCAGGGTTTTTGTGGTTTTCAGG - Intergenic
1097463638 12:59895047-59895069 CTAGACTGTGTATGGTTTTAAGG - Intergenic
1097570103 12:61321732-61321754 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
1097581755 12:61465838-61465860 TTAGAATTTTTATGGTTTCAGGG - Intergenic
1098044341 12:66384582-66384604 AGAGGGTTTTTTTGGTTTAAGGG + Intronic
1098325306 12:69296159-69296181 CCAGGAGTTTTATAGTTTTAAGG - Intergenic
1099217087 12:79866350-79866372 CTAGAATTTTAATGGTTTTTAGG - Intronic
1099485820 12:83227951-83227973 CTAGGGTTTTTATAGTTTTAGGG + Intergenic
1099513252 12:83564285-83564307 CTAGGGTTTTTAATGGTTTTAGG + Intergenic
1099527289 12:83731152-83731174 CTACAGTTTTTATGGTTTTAAGG + Intergenic
1100237889 12:92679318-92679340 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1100907152 12:99314796-99314818 CTAGGGTTTTTAGGGTTTTGGGG - Intronic
1100970832 12:100068376-100068398 CTAGAATTTTTATAGTTTCAGGG - Intronic
1101266164 12:103090221-103090243 ATCAGGTTTTTTTGGTTTTATGG + Intergenic
1101296584 12:103429999-103430021 CTAGAGTTTTCATGGTTTTTAGG - Intronic
1101630608 12:106490160-106490182 TTAGGGTATTTAGTGTTTTATGG + Intronic
1102409332 12:112703764-112703786 CTAGGGTTTTTAAAGGTTTTGGG - Intronic
1102609732 12:114101092-114101114 CTAGAGTTTTTATGGTTTTTAGG + Intergenic
1102813764 12:115845779-115845801 CTAGGATTGTTATGATTCTATGG - Intergenic
1103168700 12:118794220-118794242 CTAGGGTTTTTATGGTTTTAAGG + Intergenic
1103980157 12:124731975-124731997 CTAGGTTCTTGATGATTTTATGG - Intergenic
1104146741 12:126041316-126041338 CTGGGGTTTTTATGGTTTTAGGG + Intergenic
1104843080 12:131833907-131833929 TTAGGGAATTTATGGTTTTTGGG - Intronic
1104916558 12:132268425-132268447 CCAGGGACTTGATGGTTTTAGGG - Intronic
1105477901 13:20744796-20744818 CTAGGGTTTTTATGATTTGGGGG + Intronic
1105668025 13:22582007-22582029 CTAGGGTTTTTATGGTTTTTGGG + Intergenic
1105749093 13:23405435-23405457 CTAGGATTTTTATGGTTTTAGGG - Intronic
1106338660 13:28807750-28807772 CTAGGGTTTTGATGTTTTGTGGG + Intergenic
1106540846 13:30689176-30689198 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
1106663471 13:31826829-31826851 CAAGGGTTTTTAAGGGTTTTGGG - Intergenic
1107066989 13:36225169-36225191 CTAGGATTCTTATAGTTTGAGGG - Intronic
1107189042 13:37557775-37557797 CCAGGGTTTTTATAGTTTCTGGG - Intergenic
1107241137 13:38235739-38235761 CTAGGGTTTTTATAGTTTTGGGG - Intergenic
1107258465 13:38460657-38460679 CAAGGGTTTTTATAGTTTTGAGG - Intergenic
1107429825 13:40330307-40330329 CTAGGGTTTTTAAAGATTCATGG - Intergenic
1107538781 13:41364971-41364993 GTAGTGTTTTTATTTTTTTAAGG - Intronic
1108111361 13:47077041-47077063 CTAGGTATTTCATTGTTTTATGG - Intergenic
1109141709 13:58720169-58720191 CTAGGGGTTTTAGGTTTTTGAGG + Intergenic
1109839147 13:67900472-67900494 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1110063409 13:71069696-71069718 TTTAGGTTTTTATAGTTTTAGGG + Intergenic
1110406643 13:75158337-75158359 CCAGAGTTTTTATAGTTTTGGGG - Intergenic
1110508567 13:76320731-76320753 CTAAGAGTTTTATGGTTTCAAGG + Intergenic
1110812658 13:79827804-79827826 CTAGGGTTTTTAATGGTTTTAGG - Intergenic
1110872333 13:80467043-80467065 ATAAGGTTTTTATGGTTTTTAGG - Intergenic
1111158275 13:84357487-84357509 CCTGTGTTTTTATGCTTTTATGG - Intergenic
1111774551 13:92642877-92642899 CAAGGGACTTTATGATTTTAAGG + Intronic
1112020824 13:95369631-95369653 GTAGGGTTTTTAAGGGTTTTAGG + Intergenic
1112134472 13:96561413-96561435 CTAGGATTCTTATAGTTTTGAGG - Intronic
1113409926 13:110076219-110076241 CTAGGGCTTTTAGGGTTTTTAGG + Intergenic
1114140597 14:19905575-19905597 TGAGGGTTTTTTTGGTTCTATGG + Intergenic
1114797974 14:25738771-25738793 CCAGGATTTTTATAGTTTTGGGG - Intergenic
1115236656 14:31214377-31214399 CTAAGGTTTTTTTGTTTTTTGGG - Intergenic
1115414250 14:33112779-33112801 CTAGGGTTTTTATGGTTTTAGGG + Intronic
1115623335 14:35163882-35163904 CTAGGATTTTTATAGTTTGAGGG + Intronic
1115735795 14:36328066-36328088 CCAGGCTTTTTATAGTTTTTGGG + Intergenic
1116641169 14:47465210-47465232 CCAGGGTTTTTGTGAGTTTAGGG - Intronic
1118701310 14:68436132-68436154 CTAGGATTCTTATAGTTTGAGGG + Intronic
1119700096 14:76749301-76749323 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1120005282 14:79349631-79349653 CTAGAGGTTTTAAGGTTTTTAGG - Intronic
1120029037 14:79619316-79619338 CTAGGATTTTTATGATTTTTAGG + Intronic
1120306363 14:82775684-82775706 CTTGGGTATTTATGATTTTCTGG - Intergenic
1120329766 14:83076930-83076952 CTAGGACTTTTATAGTTTCAGGG + Intergenic
1120342158 14:83235760-83235782 GAAGTGGTTTTATGGTTTTATGG - Intergenic
1120836810 14:89046140-89046162 CAAGGGTTTTACTGGGTTTAGGG - Intergenic
1121037861 14:90721411-90721433 CTAAGGTTTTGATGGCATTAAGG + Intronic
1121934411 14:98004110-98004132 CTAGGGTTTTTTTTTTTTTTTGG - Intergenic
1122730976 14:103798005-103798027 CTGGACTTTTTATGGCTTTAGGG - Intronic
1124092414 15:26618545-26618567 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1124858796 15:33417423-33417445 CTAGGTATTTTATGTTTTTGTGG + Intronic
1126247938 15:46531679-46531701 CTAGAATTTTTATAGTTTCAGGG - Intergenic
1126283558 15:46985906-46985928 CCAGGGTTCTTATAGTTTTTGGG - Intergenic
1126669068 15:51099837-51099859 CTAGAGTCTTTGTGGTTTTCAGG + Intronic
1126981105 15:54244090-54244112 CTAGAGTGTTTATAGTTTTGGGG + Intronic
1127491317 15:59466818-59466840 CTAGGGTTTTTAGGGTTTTTAGG + Intronic
1127851938 15:62920874-62920896 CTGGGGTTTTTCTGGTTTTAGGG + Intergenic
1128291768 15:66483475-66483497 TTGGGGTTTTTGTGGTTATATGG + Intronic
1128423090 15:67513235-67513257 CTGGGTTTTTAAGGGTTTTAGGG + Intergenic
1129010902 15:72416189-72416211 CTAGGGTTTTTATGGGTTTAGGG - Intergenic
1129544155 15:76376868-76376890 TGAGGGATTTCATGGTTTTAGGG - Intronic
1131444837 15:92489700-92489722 TTAGTGTTTTTATGTTTGTAAGG - Intronic
1131643999 15:94322429-94322451 GTAGACTTTTTATGGCTTTATGG + Intronic
1134096066 16:11419479-11419501 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1134254001 16:12596668-12596690 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1134902014 16:17946882-17946904 CTAGGGTTTTCATGCTACTATGG + Intergenic
1135795509 16:25437823-25437845 CTAAGATTTTCATGGTTTTAGGG + Intergenic
1135881959 16:26266461-26266483 CTAGGGTCTTTATGGTTTTGGGG - Intergenic
1137326484 16:47442779-47442801 CTAGGGTTTTTATGGTTTTAGGG - Intronic
1138061524 16:53896311-53896333 CTAGGGTTTTTTTTTTTTTGTGG + Intronic
1138989677 16:62376088-62376110 TCAGGGTTTTTATGGTTTTTTGG - Intergenic
1140163641 16:72526414-72526436 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1141372009 16:83496539-83496561 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1142167086 16:88597855-88597877 CTGGGGCTTTTCTGGTTTAAGGG + Intronic
1145688185 17:26699677-26699699 CTAGGGTTTTCATGGTTTTAGGG - Intergenic
1145720101 17:27063259-27063281 CTGGGTTTTTGATGATTTTAAGG - Intergenic
1145829224 17:27901780-27901802 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1145977160 17:28990819-28990841 CTAGGGTTTTGGTGTTTTTTTGG - Intronic
1146556130 17:33825697-33825719 CTTAGGTTTTTATAGTTTTGAGG - Intronic
1148931756 17:51132613-51132635 CTGGGTTTTTTATGTTTTTGAGG - Intergenic
1149159821 17:53678612-53678634 CTAGGAATTTTATAATTTTAAGG + Intergenic
1149174879 17:53857801-53857823 CTAGGGTTTTTATGGTTTTGGGG - Intergenic
1150321775 17:64220234-64220256 CTAGGGTTTTTATAGTTTTTGGG - Intronic
1152856588 17:82668216-82668238 CTGGGGTTTTTGTGGTCTTCAGG + Intronic
1153094776 18:1388333-1388355 CTGTGGTTTTTATACTTTTAGGG - Intergenic
1153351371 18:4084079-4084101 CTAGGATTTTTAAGGGTTTTGGG - Intronic
1154444394 18:14422940-14422962 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
1155641479 18:28021654-28021676 ATAAGGATATTATGGTTTTATGG - Intronic
1155733907 18:29197413-29197435 CTAGAATTTTTATAGTTTCAGGG + Intergenic
1156355981 18:36340422-36340444 CAAAGGTTTTTATTGTTTGAAGG + Intronic
1156815336 18:41303855-41303877 CTAGGGATTGTATGTTTTTGTGG - Intergenic
1156970458 18:43147920-43147942 CTTGGGTTTTTTTGGTTTTGGGG - Intergenic
1157148783 18:45193345-45193367 CTAGAAGTTTTATTGTTTTAAGG + Intergenic
1158035089 18:53018946-53018968 CTAGTGTTTTAATGCTCTTAAGG - Intronic
1158667428 18:59445150-59445172 CTAGGATTTTCATAGTTTTGGGG + Intronic
1158676610 18:59525704-59525726 CTAGGGTTTTTATAGTTTTGGGG + Intronic
1159258951 18:65986336-65986358 CTAGGTTTTATATGAGTTTAAGG + Intergenic
1159366174 18:67468266-67468288 CAAGGCTTTTTATGGTCTCAGGG + Intergenic
1159645277 18:70911017-70911039 CTAGGACTTCTATGGTCTTAAGG + Intergenic
1159722270 18:71906478-71906500 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
1160068647 18:75604506-75604528 CTAGGGCTTTTTTGGCTTTAGGG - Intergenic
1161585049 19:5101547-5101569 CTTGGGTTTTTTGGGTTTTGGGG - Intronic
1162640568 19:12005921-12005943 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1162848142 19:13409946-13409968 CTAATGTTTTTATATTTTTATGG - Intronic
1163120706 19:15215780-15215802 TTTGGGTTTTTTTGGTTTTTTGG + Intergenic
1163180631 19:15598313-15598335 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1164482473 19:28623601-28623623 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
1164495963 19:28761835-28761857 CTAGAGTTTTTATGGTTTTCAGG - Intergenic
1165240978 19:34467094-34467116 CTAGTAGTTTTATGGATTTATGG - Intronic
1167397198 19:49238302-49238324 TTAGATTTTTTATGGTTTCAGGG + Intergenic
1167570549 19:50285465-50285487 CTAAGTATTTCATGGTTTTATGG + Intronic
1168229721 19:55022261-55022283 CTAGGGTTTTTATAGTTTTCGGG + Intronic
1202656956 1_KI270708v1_random:32658-32680 CTATGGTTTTTATTGTGTTGTGG + Intergenic
926004266 2:9360355-9360377 CTAGGGTTATGAAGCTTTTAAGG + Intronic
926378233 2:12256789-12256811 CTAGGTTTTTTTTTCTTTTATGG + Intergenic
926402529 2:12512752-12512774 CTAGGGATTTTATGGTTAATAGG + Intergenic
927039321 2:19212411-19212433 CTAGGGTTTTTGTGGTTTTTAGG - Intergenic
927526029 2:23741581-23741603 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
928592304 2:32829893-32829915 CCAGGGTTTTTATAGTTTTGGGG - Intergenic
929062450 2:37937006-37937028 CTAGGGTTTTTATGGTTTTCAGG + Intronic
930440616 2:51400005-51400027 CTAGGATTAGTATGTTTTTAGGG + Intergenic
930705092 2:54497158-54497180 CTAGGGTTTCTCTGGTCTTACGG - Intronic
930930750 2:56879049-56879071 CCAGAGTTTTTATAGTTTTGGGG - Intergenic
932651236 2:73559910-73559932 CTGGGAGTTTTATGGTTTTAAGG - Intronic
933039020 2:77437720-77437742 TTAGGGTTTTTGTGTTTCTATGG + Intronic
933427077 2:82126761-82126783 TTAGGATTTTTATGGGTTCAGGG + Intergenic
933487782 2:82945364-82945386 CTAGGATTTTTATGGTTTTATGG + Intergenic
933696776 2:85224892-85224914 CTAGGGTTTTTATGGTTTTAGGG + Intronic
933904828 2:86881357-86881379 CTGGAATTTTTATGGTTTCAGGG - Intergenic
935063403 2:99627683-99627705 CCAGGGTTTTTATAGTTTTGGGG + Intronic
935338620 2:102039646-102039668 CCAGGGTTTTTGTAGTTTTGGGG + Intergenic
935420414 2:102862712-102862734 TTAGGTTTTTTATAGTTTTCTGG - Intergenic
936367402 2:111870806-111870828 CTAGAATTTTTATGGTTTCAGGG + Intronic
936752889 2:115667456-115667478 CCAGGATTTTTATAGTTTCAGGG + Intronic
936769082 2:115890193-115890215 CTAGGGTTTTCATGGTTTTTAGG + Intergenic
937186313 2:120046772-120046794 CTAGGGTTTTTATGGTTTTTAGG + Intronic
938375623 2:130804087-130804109 CTAGGAGTTTTATAGTTCTAAGG - Intergenic
939224474 2:139347541-139347563 CTAGGGTTTCTATGATTTTAGGG + Intergenic
939594734 2:144109424-144109446 CTAGGGTTTTTATGGTTTTTAGG - Intronic
939796174 2:146646874-146646896 CTAGGGTTTTTATGGTTTTATGG - Intergenic
940083802 2:149835201-149835223 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
940182052 2:150945325-150945347 CTAGTAATTTTATTGTTTTAAGG - Intergenic
940231396 2:151457082-151457104 ATAGGGTTTTTTTTTTTTTAAGG + Intronic
940366581 2:152854882-152854904 CTAGAGTTTGTATACTTTTAGGG + Intergenic
940560653 2:155291584-155291606 CCAGGGTTTTCATGGTTTTAGGG + Intergenic
940666953 2:156620633-156620655 CTAGGCTTTTTATTTTTTTGAGG + Intergenic
940747860 2:157590058-157590080 CTAGAATTTTTCTGGTTTTAGGG - Intronic
941032275 2:160526133-160526155 CCAGGGTTTTTATGGTTTTAGGG + Intergenic
941127185 2:161598398-161598420 CTAGGATTTTTATAATTTGAGGG - Intronic
941193011 2:162410457-162410479 CTAGAGTTTTTATTGTTTTTAGG - Intronic
941608638 2:167632909-167632931 CTAGGGGTTTTATGGTTTTAAGG + Intergenic
942065346 2:172265817-172265839 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
942318281 2:174713977-174713999 CTGGGTATTTTATGTTTTTATGG + Intergenic
943136052 2:183914257-183914279 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
943152565 2:184133162-184133184 CCAGAGTTTTTATAGTTTTGGGG + Intergenic
943160648 2:184245631-184245653 CTAGGATTTTTATGGTTTTAGGG - Intergenic
943250614 2:185517446-185517468 CTAGGATTTTCTTGGTTATATGG + Intergenic
943250668 2:185518110-185518132 CTAGGATTTTCTTGGTTATATGG - Intergenic
943359174 2:186897188-186897210 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
943498463 2:188654562-188654584 CTAGAGTTTTTTGAGTTTTAGGG - Intergenic
944305782 2:198177298-198177320 CTAGGATTTTTATGGTTTCAGGG + Intronic
944327749 2:198426735-198426757 CTAGGGTTTGTATGGTTTTAGGG + Intronic
944608408 2:201374648-201374670 GTAGGGTTTTTATGGTTTTAGGG - Intergenic
945742021 2:213675498-213675520 CTAGGGATTTTATGGTTTTAGGG + Intronic
945827858 2:214746733-214746755 CTAGGGTTTTTAATGGTTTTAGG - Intronic
946135247 2:217641210-217641232 CTAGGGTGCTTTTGGTTTCATGG - Intronic
946456262 2:219828936-219828958 ATAGGGTATTTATGGATTTGGGG + Intergenic
947168537 2:227287462-227287484 CTTGGTTTTGTATGGCTTTAGGG - Intronic
949070928 2:242023633-242023655 CTAGTGTTTTTCTAGTTTGAGGG + Intergenic
1169265824 20:4166890-4166912 TTAGGGACTTTATGATTTTAGGG + Intronic
1169460711 20:5792302-5792324 CTAGGAGTTTTATAGTTTTAGGG + Intronic
1169538252 20:6570553-6570575 CTAGAGTTTTTACAGTTTGAGGG - Intergenic
1169562018 20:6811775-6811797 CTTGGGTTTTCATTCTTTTAGGG - Intergenic
1170242870 20:14189520-14189542 TTAGAGTTTTTAAGGTTATAGGG + Intronic
1170525421 20:17231141-17231163 CTAGGGGTTTCATTGTATTATGG + Intronic
1170707333 20:18756383-18756405 CTAGGGTTTTTATGGTTTTATGG + Intronic
1171005064 20:21456504-21456526 TTAGGGTTTTTATAGTTTTTGGG + Intergenic
1173145030 20:40517186-40517208 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1174109616 20:48189601-48189623 CCAGTGTTCTTATTGTTTTATGG + Intergenic
1176153120 20:63603399-63603421 CTAAGGTTTTAAAGGTTCTAGGG + Intronic
1176451587 21:6866925-6866947 CTAGGGTTTTTATAGTTTTTAGG - Intergenic
1176829755 21:13731976-13731998 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1177136736 21:17312418-17312440 CCAGGCTTTTTTTGGTTTTTAGG - Intergenic
1177339490 21:19781902-19781924 CTAGGGTCTTGAGGTTTTTAAGG - Intergenic
1177433321 21:21018808-21018830 CTAGCAGGTTTATGGTTTTATGG + Intronic
1177764794 21:25445062-25445084 CTAGGGTTTTTATAGTTTTTGGG - Intergenic
1178455467 21:32746145-32746167 CTAGGATTTTTATAGTTTTGGGG - Intronic
1179239693 21:39579313-39579335 CTGGGGTTTTTATGGGTCTTGGG - Intronic
1180504020 22:15973747-15973769 CTATGGTTTTTATGGTTTTAGGG - Intergenic
1181081126 22:20416216-20416238 CTAGGGTTTTTACGGTTTTTGGG + Intergenic
1181121966 22:20675494-20675516 CTAGAAGTTTTATGGTTTCAGGG + Intergenic
1181405486 22:22681602-22681624 GAAGGGTATTTATGGTTTTCTGG + Intergenic
1181449090 22:23005527-23005549 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
1182040426 22:27234683-27234705 CTAGGGTTTTAATGCTTTTAGGG - Intergenic
1182986014 22:34717303-34717325 CTAGGTATTTTATTGTTTTGTGG + Intergenic
1183660511 22:39217833-39217855 CTAGGGTTTTTAATGGTTTTAGG - Intergenic
1203334557 22_KI270739v1_random:48765-48787 CTATGGTTTTTATGGTTTTAGGG + Intergenic
949119483 3:368705-368727 CTAGGGTTTTTAATGGTTTTGGG + Intronic
949155450 3:821509-821531 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
950130332 3:10539746-10539768 CTAGGGTTTTTATGGTTTTTAGG - Intronic
950309834 3:11947601-11947623 CTAGGGTTTTTATGGCTTTAGGG + Intergenic
950701448 3:14752361-14752383 CTAGGGTTTTTATGGTTTTTAGG - Intronic
950978891 3:17280464-17280486 CTGGGGTTTTTATGGGTATAGGG - Intronic
951380804 3:21982319-21982341 CTAGGTATTTTATTCTTTTATGG + Intronic
951490305 3:23262872-23262894 CTAGGAGTTTTATGGTTTCAGGG + Intronic
952023616 3:29052722-29052744 GCAGGGTTTTTATGGTTTTAGGG + Intergenic
952109741 3:30108912-30108934 CTTGGGTTTTTATGGTTACAGGG - Intergenic
952287749 3:31984343-31984365 CTAAGGTTTTTTTTTTTTTAAGG + Intronic
952392992 3:32896946-32896968 CTGGGGTTTTCTTGCTTTTAGGG + Exonic
952574017 3:34752663-34752685 CTAGGATTTTTATAGTTTGAGGG - Intergenic
952694987 3:36254492-36254514 CTAGGGTTTTTATAGTTTTGGGG - Intergenic
953074519 3:39556227-39556249 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
953116638 3:39999056-39999078 CTAGGGTTTTTATGGTTTTTAGG - Intronic
953155644 3:40370104-40370126 CTAGGTATTTTATGTTTTTCAGG - Intergenic
953189840 3:40675009-40675031 CTAGGATTTTTATTGTTTCAGGG - Intergenic
953230435 3:41060045-41060067 CTAGGATTATTATAGTTTGAGGG + Intergenic
953516410 3:43596641-43596663 CTAGGGTTTTTAATGGTTTTCGG - Intronic
954500340 3:51007733-51007755 CTAGGGTTTTTATGGTTTTTAGG + Intronic
954833292 3:53441851-53441873 GTAGGGTTTTTATGGTTTTTAGG + Intergenic
954889354 3:53910320-53910342 ATTGGGTTTTTTTGGTTTTCTGG - Intergenic
955032632 3:55235776-55235798 CTAGAATTTTTATGGTTTTTGGG + Intergenic
956570771 3:70691874-70691896 CTCGCGTTTTTATGATTCTAGGG - Intergenic
956600314 3:71014029-71014051 CTAGGGATTTTATGGTTTTTAGG - Intronic
958254432 3:91308815-91308837 CTAGGTATTTTATGCTTTTTGGG - Intergenic
958527627 3:95284055-95284077 CTAGGGTTTTTATGGGTTTTAGG + Intergenic
959268817 3:104178159-104178181 CCAGGGTTTTTATAGTTTTATGG + Intergenic
959482720 3:106893030-106893052 CCAGGATTTTTATGGTTTTTGGG - Intergenic
959801314 3:110498542-110498564 CTAGGCTTTTTTTGGTTGTTAGG - Intergenic
959880754 3:111442260-111442282 CTAGGGTTTTCATGGTTTTTAGG + Intronic
960017099 3:112903689-112903711 CTAGGGTTCTTATAGTTTTGGGG + Intergenic
962408435 3:135120324-135120346 CTAGGTATTTTATGGTTTTGTGG + Intronic
963262743 3:143209363-143209385 CTTGGGTTTTTATGGTGATTAGG + Intergenic
963360044 3:144260326-144260348 CTGGGGTTTTTTTGGTTGTTAGG + Intergenic
963457229 3:145559435-145559457 CTAGTAGTTTTATGGCTTTAAGG + Intergenic
963805753 3:149720231-149720253 CTAAGAGTTTTATAGTTTTAGGG + Intronic
964020425 3:152003743-152003765 AAAGGGTTTTTTTGTTTTTAAGG - Intergenic
964137987 3:153367071-153367093 CCAGAGTTTTTATAGTTTTGGGG + Intergenic
965227710 3:166010837-166010859 TTAGGATTTTTATAGTTTTCAGG + Intergenic
965264115 3:166518637-166518659 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
965392853 3:168126942-168126964 CTAGTAGTTTTATGGTTTCAGGG - Intergenic
965795072 3:172431176-172431198 TTTGGGTTTTAAGGGTTTTATGG + Intergenic
965974981 3:174610193-174610215 CTAGGGTTTTTATGGTTTTTAGG - Intronic
966617543 3:181928197-181928219 CCAGGGTTTTTATAGTTTTGGGG + Intergenic
966967145 3:185004986-185005008 CAAGGGTTTTTATGGATTCAGGG + Intronic
967232039 3:187348522-187348544 CTAGAAGTTTTATAGTTTTAGGG + Intergenic
967747455 3:193073322-193073344 CTTGAGTTTTTTTTGTTTTATGG - Intergenic
968292323 3:197548217-197548239 ACTGGCTTTTTATGGTTTTATGG + Intronic
968537507 4:1143726-1143748 TCAGGGTGTTTATGGTTTCATGG - Intergenic
969009810 4:4052612-4052634 CTAGGATTTTTATGATTTTTAGG - Intergenic
970642877 4:18087147-18087169 CTAGGGTTTTTATAGTTTTGGGG - Intergenic
970815061 4:20145411-20145433 CTAGGATTTTTATGGTTTTAGGG - Intergenic
971174700 4:24270911-24270933 CTGGGTATTTTATGTTTTTATGG - Intergenic
971270246 4:25137093-25137115 CTAGGGTTTTTATAATTTGGGGG - Intronic
971503040 4:27337040-27337062 CTATGGTCTTTATGGTACTAAGG + Intergenic
972210115 4:36826253-36826275 CAAGTGTTTGTATGGTTTTGAGG - Intergenic
972295387 4:37732880-37732902 CTATAGATTTTATGGGTTTATGG + Intergenic
973905651 4:55527680-55527702 CTAGGTGTTTTATGATATTAAGG + Intronic
974065762 4:57075602-57075624 GTGTGCTTTTTATGGTTTTATGG - Intronic
974182604 4:58402692-58402714 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
974250809 4:59380283-59380305 CTAGGTTTTTTATAGTTTTGAGG - Intergenic
974899053 4:67974050-67974072 CTAAGGTTTTTATGGTTTGGGGG + Intergenic
975175196 4:71280503-71280525 CTAGGAGTTTTATGGTTTCAGGG + Intronic
975306537 4:72855800-72855822 CTAGGATTTTTATGGTTTTTAGG - Intergenic
975408975 4:74025637-74025659 TTAGGGGTTTTGTGGTTTTATGG + Intergenic
975909554 4:79250509-79250531 CCAGAGTTTTTATACTTTTAGGG - Intronic
976594774 4:86884814-86884836 CTAGGGTTTTTATGGTTTTTAGG + Intronic
976627237 4:87199360-87199382 CTAGTCATTTTATGGTTTCAGGG - Intronic
976903125 4:90204304-90204326 CTAGAGTTTTTATGATTTTTAGG + Intronic
976949160 4:90808269-90808291 ATATAATTTTTATGGTTTTAGGG - Intronic
977978559 4:103296063-103296085 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
977978829 4:103298646-103298668 CCAGGGTTTTTATAGTTTTTGGG + Intergenic
978911461 4:114068897-114068919 CTAGGGTTTTTAATGGTTTTAGG - Intergenic
978940012 4:114424859-114424881 CTAGGGTTTTTTTTGGTTTTGGG + Intergenic
979370435 4:119879487-119879509 TTAGGGTTTTTATAGTTTTAGGG - Intergenic
979692192 4:123571880-123571902 CTAGGATTCTTATAGTTTGAGGG - Intergenic
979775933 4:124588479-124588501 CTAAGGTTTTTATGGTTTGGGGG - Intergenic
980099867 4:128530996-128531018 CTAGGATTTTTATGGTTTTTGGG + Intergenic
980509541 4:133767278-133767300 CCAGGGTTTTTATAGTTTTGGGG + Intergenic
980516964 4:133876730-133876752 CTAGGTATTTTATTATTTTAGGG + Intergenic
980562233 4:134492594-134492616 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
980729454 4:136808213-136808235 CTAAAGTTTTTACGTTTTTAGGG + Intergenic
981223734 4:142267598-142267620 CTAGTACTTTTATAGTTTTAGGG - Intronic
981344548 4:143660195-143660217 CTAGGGTTTTTAATGGTTTTAGG + Intronic
981408242 4:144396555-144396577 CTAGGGTTTTTATGGTGTTAGGG - Intergenic
981442856 4:144802886-144802908 ATAGAATTTTTATGGTTTCAAGG + Intergenic
981448252 4:144865868-144865890 CTAGGGTTTTTATGGTTTTGGGG + Intergenic
981456359 4:144957717-144957739 CAAGGGTTTTTATGGTTTTAGGG + Intergenic
981533184 4:145772983-145773005 CTATGGTTTCTATGGTGGTATGG + Intronic
981605969 4:146540855-146540877 CCAGAGTTTTTATAGTTTTGGGG + Intergenic
982540012 4:156656892-156656914 CTATTGTTTGTATTGTTTTATGG + Intergenic
982625027 4:157755932-157755954 CCAGGATTTTTATGGTCCTAGGG + Intergenic
983199422 4:164844864-164844886 CTAGAGTTTTTCTGGTTGTTTGG + Intergenic
983821438 4:172198130-172198152 CTAAGGATTTTATAGTTTTGGGG - Intronic
984512589 4:180696892-180696914 CTAGGGTTTGTTTGGTCTAAAGG - Intergenic
984618514 4:181926547-181926569 CTAAGGTTTTTTGGGTTTTGGGG + Intergenic
984724374 4:183006482-183006504 CTAAGATTTTAATAGTTTTAGGG - Intergenic
985240304 4:187924253-187924275 CTAGAATTTTTATAGTTTCAGGG + Intergenic
986152729 5:5142089-5142111 CTGGAATTTTCATGGTTTTAGGG - Intronic
986296329 5:6442004-6442026 CCAAGGTTTTTATAGTTTTTGGG + Intergenic
986617984 5:9639337-9639359 CTAGGGATAAAATGGTTTTAGGG - Intronic
987250078 5:16090904-16090926 CTATGGAATGTATGGTTTTATGG - Exonic
987270044 5:16298088-16298110 CTAGGTATTTTATTATTTTATGG - Intergenic
987769528 5:22282272-22282294 CTAGGGTTGTTATGATTTTTAGG - Intronic
987817335 5:22919662-22919684 CTAGGATTTTTATGGTTTTGGGG - Intergenic
987881231 5:23749139-23749161 CTAACTTATTTATGGTTTTATGG - Intergenic
987893675 5:23917054-23917076 CTAGGGTTTTTATGATTTTTAGG + Intergenic
988328190 5:29798628-29798650 ATAGGGTTTTTATGGTTTTTTGG + Intergenic
988336136 5:29910880-29910902 CCAGGTTTTTTAGAGTTTTAGGG - Intergenic
989195281 5:38710242-38710264 ACACGGTTTTCATGGTTTTAGGG - Intergenic
989583921 5:43059451-43059473 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
989696137 5:44202772-44202794 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
990022816 5:51148968-51148990 CTAGGGTTTTTTTTTTTTTCTGG - Intergenic
990277947 5:54218946-54218968 CTATGGATTTTAACGTTTTACGG + Intronic
990463113 5:56047763-56047785 CTGGGGTTTTTATGGGTACAGGG - Intergenic
990642324 5:57800806-57800828 CTAGTATTTTTATAGTTTTGGGG + Intergenic
991111770 5:62908222-62908244 GCAGGGTTTTAATGGTTTAAGGG + Intergenic
992291842 5:75287458-75287480 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
992599628 5:78385737-78385759 CATGTATTTTTATGGTTTTAAGG + Intronic
992897881 5:81262220-81262242 CTAGGGTTTTTATGGTTTTTAGG - Intronic
993083065 5:83326365-83326387 CTAGGATTTTTATAGTTTTTGGG + Intronic
993146437 5:84099607-84099629 CTAGGATTTTTATGGTTTTAAGG - Intronic
993364962 5:87024136-87024158 CTAAGGTTTTTTTGGTTTTGGGG + Intergenic
993813581 5:92513084-92513106 CTAGGGTTTTTAAGGATATTTGG + Intergenic
993930569 5:93934070-93934092 CTAGGAATTTTATAGTTTTATGG - Intronic
994183602 5:96794923-96794945 CTGGGGTTTTTGTGGCTTGAGGG + Intronic
994500849 5:100575562-100575584 CTAGGGTTTTTATGGTTTTAGGG - Intronic
994651350 5:102533409-102533431 CTAGGGCTTTTATGGTTTTAGGG - Intergenic
994713743 5:103297238-103297260 CTACCATTTTTATGGTATTATGG - Intergenic
994930220 5:106173180-106173202 TTAGGGTATTTAAGGGTTTAGGG - Intergenic
995306311 5:110654932-110654954 CTAGGGATTTTATGGTTTTTAGG - Intronic
995460198 5:112395123-112395145 CTAGGGTTCGTATGGTTTTAGGG - Intronic
995666928 5:114553000-114553022 CCAGGGTTTTTATAGTTTTGGGG - Intergenic
995698206 5:114903396-114903418 CTAGGATTTTTATAGTTTGAAGG + Intergenic
995800820 5:115992333-115992355 CTGGGGTTTTTATGCTATTTTGG - Intronic
995959531 5:117822862-117822884 CTAAGGTTTTTGTGTTTTTTTGG + Intergenic
996454844 5:123669077-123669099 CCAAGGTTTTTATAGTTTTGGGG - Intergenic
996878828 5:128270218-128270240 CTAGGGTTTTTTATGGTTTAGGG - Intronic
996991656 5:129640583-129640605 CTAGGGACTTTATGTTTGTAGGG - Intronic
997115087 5:131117942-131117964 CTAGGGTTTTCATGGTTTTTAGG + Intergenic
997404166 5:133631026-133631048 CTAGGGTTTTTAATGGTTTTAGG - Intergenic
998597943 5:143553674-143553696 TTAGGGTTTTTTGGGTTTTTTGG - Intergenic
998791129 5:145767138-145767160 CTGGGGTTTTTATGGGTACAGGG - Intronic
998872068 5:146562169-146562191 CTAGGTGTTTTATGGGTTTTAGG + Intergenic
1001148846 5:169208833-169208855 GTAGGGTTTTTATGGTTTTAGGG - Intronic
1001179751 5:169508737-169508759 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1002475887 5:179465884-179465906 TTATGGTTTTTATGGTTTTGTGG + Intergenic
1002860520 6:1075569-1075591 CCAGAGTTTGTTTGGTTTTAAGG - Intergenic
1003185736 6:3828979-3829001 CTATGGTGTTTATTTTTTTAAGG + Intergenic
1003299305 6:4862456-4862478 CTATGGGTTTTATGTTTATAAGG - Intronic
1003594059 6:7458961-7458983 GGAGGGTTTTGATGGTTGTACGG - Intergenic
1003680828 6:8253489-8253511 TTAGGGTTTTTATAGGTTTTAGG - Intergenic
1003852996 6:10243947-10243969 CCAGGGTATTTATACTTTTATGG + Intergenic
1003980267 6:11382637-11382659 ATTGGGATTTTATGGTTTTATGG + Intergenic
1004032327 6:11882889-11882911 CTAGGATTTTTATGGTTTTTAGG - Intergenic
1004772762 6:18803293-18803315 CTAGGAGTTTTATGCTTTTTTGG + Intergenic
1006050809 6:31342428-31342450 CTAGGGTTTTTATGGTTTTAGGG - Intronic
1006532814 6:34671583-34671605 TTAGGATTTATATGGTTTTTTGG - Intronic
1007134136 6:39505379-39505401 ATAGGGTTTTTATAGTTCTGGGG - Intronic
1007890577 6:45286124-45286146 CTAGGGTTTTTATGGTTTTAGGG - Intronic
1008173647 6:48239416-48239438 CCAAGGTTTTTATAGTTTTGGGG - Intergenic
1008677612 6:53837130-53837152 TTTGGGTTTTTATAGTTTTGGGG + Intronic
1008785598 6:55163655-55163677 CTAGGGTTCTTATGGTTTTTAGG - Intronic
1009189399 6:60611671-60611693 CTAGGTATTTTATGCTTTTTGGG + Intergenic
1009489176 6:64266389-64266411 CTCGGGTTTTTTTAGTTTTGGGG - Intronic
1009497454 6:64369016-64369038 CCAGGGATTTTATAGTTTGAGGG + Intronic
1009648948 6:66448391-66448413 CTAGCATTTTTATGGTTTTAGGG - Intergenic
1009722304 6:67487989-67488011 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
1010159068 6:72830613-72830635 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1010191896 6:73204285-73204307 CCAGTCCTTTTATGGTTTTATGG + Intergenic
1010575365 6:77523442-77523464 CTAGGGTTTTTATGATTTTTAGG - Intergenic
1010612508 6:77971210-77971232 CTAAGATTTTTATAGTTTGAGGG - Intergenic
1010721682 6:79289682-79289704 CTAGGGTATTTATGGTTATTAGG - Intergenic
1011062091 6:83282142-83282164 CTAGAGTTTTTATGGTTTTAAGG - Intronic
1011156190 6:84335893-84335915 CTAGAATTTTTATGTTTTTCAGG + Intergenic
1011309206 6:85963404-85963426 ATATGGTTTTTATTATTTTAAGG + Intergenic
1011503468 6:88015808-88015830 CCAGGGTTTTTATAGTTTTAGGG + Intergenic
1011741683 6:90367604-90367626 CTAGGAGTTTTATGGTATCAGGG + Intergenic
1012656514 6:101829648-101829670 CTAGGTTCTTTATATTTTTATGG - Intronic
1013227430 6:108130216-108130238 ATATGATTTTTCTGGTTTTATGG - Intronic
1013892222 6:115037774-115037796 CTAGGGTTTTTATGATTTTTAGG - Intergenic
1014043640 6:116857807-116857829 AAATGGTTTTTCTGGTTTTAGGG + Intergenic
1014233818 6:118934155-118934177 CTAGCATTTCTATGGTTATATGG + Intronic
1014243951 6:119047739-119047761 CTGGGCTTTTTTTGGTTTTTAGG - Intronic
1014392725 6:120883688-120883710 CTAGTGCTTTTATGGTTCTCAGG - Intergenic
1014533451 6:122588136-122588158 CTATGGTTTTTATGGTTTTAGGG + Intronic
1015849247 6:137554610-137554632 CTAGAATTTTTATAGTTTCATGG + Intergenic
1016207928 6:141492126-141492148 CTAAGGTTACTATGGATTTAGGG + Intergenic
1016291303 6:142531102-142531124 CTTGTGTTTTTTTGGTTTTTTGG - Intergenic
1016423298 6:143907889-143907911 CTATGGTTTTTCTAGTTTTTGGG + Intronic
1017390679 6:153935845-153935867 CTAGAGTTTTTACAGTTTTGGGG + Intergenic
1017794860 6:157834890-157834912 CTAGGGTTTTGGAGCTTTTAGGG - Intronic
1017986913 6:159452143-159452165 CTAGGGTTTATATTTTGTTATGG + Intergenic
1018760412 6:166889840-166889862 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1020446142 7:8270275-8270297 CTAGGGGTTTTATACTTTTGTGG - Intergenic
1021208326 7:17812026-17812048 CTAGGGTTTTTATGTTTTTTAGG - Intronic
1021585226 7:22200781-22200803 CTAGGCTTGCTCTGGTTTTAGGG - Intronic
1022218041 7:28283942-28283964 CTAGGGTTTTTATGGTTTTATGG - Intergenic
1022934355 7:35156826-35156848 CTAGGGTTTTTGTGGTATTTAGG - Intergenic
1023450571 7:40280213-40280235 CCACAGTTTTTATAGTTTTAAGG + Intronic
1024135806 7:46406757-46406779 CTAGGGTCTTTAAGCCTTTATGG + Intergenic
1024847450 7:53663690-53663712 CTAGAATTTTTATGGTTTCAGGG + Intergenic
1025116920 7:56266221-56266243 ATAGGGTTTTTAGGATTTTTAGG - Intergenic
1027193949 7:76015399-76015421 CTAGGATTTCTATAGTTTTCAGG - Intronic
1027640169 7:80723449-80723471 TTAAGCTTTTTAAGGTTTTAAGG - Intergenic
1027928348 7:84497328-84497350 CATGGGGATTTATGGTTTTAAGG - Intergenic
1028098874 7:86796175-86796197 ATAGGGTTTTTATAGTTTTGGGG + Intronic
1028186222 7:87788499-87788521 TTTTGGTTCTTATGGTTTTATGG + Intronic
1028374281 7:90130007-90130029 CTAGGGTTTTGATAGTTTTAAGG + Intergenic
1028523481 7:91758078-91758100 CTAGGGTTTTTATAATTTTGGGG - Intronic
1028561871 7:92184857-92184879 CTAGGGTTTTTAATGGTTTTAGG + Intergenic
1029574755 7:101396094-101396116 CTAATGTTTTTTTGGTTTTTTGG - Intronic
1029919306 7:104245530-104245552 CTAGGGTTTTTATGATTTAAGGG + Intergenic
1029975642 7:104830444-104830466 CTAGGGTTTTTAATGGTTTTAGG + Intronic
1030320007 7:108156332-108156354 CTAGGTTTATTCTGGTTTTAAGG + Intronic
1031032533 7:116750461-116750483 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1031696470 7:124861716-124861738 CTAGGGTTTTTATGGTTTTAGGG + Intronic
1032659281 7:133965441-133965463 CTAGGGTTTTTATGCTTTTAGGG + Intronic
1034017602 7:147604101-147604123 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1034381420 7:150697651-150697673 CCAGGGTTTATATAGTTTTTGGG - Intergenic
1035546607 8:486653-486675 ATGGGGGTTTTGTGGTTTTAAGG - Intergenic
1035900244 8:3451428-3451450 CTAGGGTTTTTATGGTTTTAGGG + Intronic
1036120904 8:6016800-6016822 CTAGTGTTTTTATTTTTTTATGG - Intergenic
1036585927 8:10123626-10123648 CCAGAGTTTTTATAGTTTTGAGG + Intronic
1037179420 8:15987026-15987048 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1037462319 8:19123940-19123962 CTAGAAGTTTTATAGTTTTATGG + Intergenic
1037578168 8:20227623-20227645 TTAAGGTGTTTCTGGTTTTAGGG - Intergenic
1038095361 8:24303254-24303276 CTAGGGTTTTTATAGTTTTTGGG + Intronic
1038414775 8:27386782-27386804 CAATGGTTTTGTTGGTTTTAAGG + Intronic
1038611738 8:29065297-29065319 CTAGGATCCTGATGGTTTTAGGG - Intergenic
1038866521 8:31444405-31444427 CTAGGGTTTTTAATGGTTTTAGG - Intergenic
1038916778 8:32032880-32032902 CTAGGGTTTTTATAGTTTTGGGG + Intronic
1040363621 8:46691672-46691694 TTTGGGTTTTTATGGTTTTATGG + Intergenic
1040401381 8:47053101-47053123 CTAGAGTTTTTACAGTTTTTGGG - Intergenic
1040432181 8:47353960-47353982 ATGGGGTTTTTTTGCTTTTAAGG + Intronic
1041078132 8:54187727-54187749 CTAGGGTTGTTATGGTTGATGGG + Intergenic
1041129531 8:54682911-54682933 CTAGGGTTTTTATTGTTTTGGGG + Intergenic
1041653419 8:60323586-60323608 TTAGGGTTTTTATAGTTTTTGGG + Intergenic
1041965217 8:63668032-63668054 CTAGGTTTCTTTTGATTTTACGG + Intergenic
1042038692 8:64567334-64567356 TTAAGATTTTTATGGTTTTCTGG - Intergenic
1042066433 8:64882518-64882540 CTAAGGTTTTTAAGGATTTGGGG - Intergenic
1042624593 8:70743771-70743793 CTACAGTTTTAGTGGTTTTAAGG - Intronic
1042946638 8:74161511-74161533 GTAGGGTTTTTATGGTTTTTAGG - Intergenic
1043761828 8:84077902-84077924 CTAAGGTTTTTATGGTTTTAGGG + Intergenic
1043929743 8:86076985-86077007 CTAGGACTTTTATGGTCCTAGGG + Intronic
1044318783 8:90779218-90779240 CTAGGATTTTTATAGTTTGAGGG + Intronic
1044610328 8:94085395-94085417 CTAGGGTTATTGTGGTTTTTGGG + Intergenic
1045014974 8:97993313-97993335 TGAGGGTTTTTATTATTTTAAGG - Intronic
1045835118 8:106511156-106511178 CTTGGGTTTTGCTGATTTTATGG + Intronic
1045933655 8:107655270-107655292 CCAGGGTTTTTTTATTTTTATGG - Intergenic
1046436134 8:114191990-114192012 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1046683359 8:117196441-117196463 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
1047631146 8:126709998-126710020 CTAGGGTTTTTGTGGTTTTAGGG - Intergenic
1047948434 8:129906480-129906502 CTAGGGTTTTTATGGTTTTAGGG - Intronic
1048476898 8:134751723-134751745 CTAGGGATTTTAAGTTTTTCAGG - Intergenic
1050397517 9:5214904-5214926 CTAGAGTTTTTATGGTTTTAGGG - Intergenic
1051178797 9:14388588-14388610 ATAGACTTTTGATGGTTTTAAGG - Intronic
1051549190 9:18310215-18310237 CTAGGATTTTTATGGTTTTAGGG - Intergenic
1051764166 9:20503572-20503594 CTAGTATTTTTATGGTTTCAAGG - Intronic
1051914706 9:22194367-22194389 CTAGGGTTTTGATTATTTTTGGG + Intergenic
1052671407 9:31561900-31561922 CCAGGGTTTTTACAGTTTTGGGG - Intergenic
1052690010 9:31805457-31805479 ATACGGTTTTTATTGTTTTGAGG - Intergenic
1052779973 9:32771565-32771587 TCAGGGTTTTTATAGTTTTCAGG + Intergenic
1052800500 9:32962837-32962859 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1054779049 9:69149778-69149800 CTTGGGTTTTCTTGGTCTTAGGG + Intronic
1054967062 9:71041382-71041404 AGAGGGTTATTATGGTTTGAAGG - Intronic
1054970101 9:71076250-71076272 ATAGCGTTTTTCTGGTTTCATGG - Intronic
1055178138 9:73346657-73346679 CTAAATTTTTTATTGTTTTAGGG + Intergenic
1055386379 9:75767058-75767080 CTAGGGTTTTTAATGGTTTTAGG + Intergenic
1055988950 9:82084382-82084404 ATAGTGTTTTTATTGTTTTGTGG + Intergenic
1056124192 9:83519020-83519042 CTAGGGTTTTTATGGTTTTAGGG - Intronic
1056221907 9:84458090-84458112 CTAGGGTTTTTATGGTTTTTAGG + Intergenic
1056556087 9:87689047-87689069 CTAGGATTCTTATAGTTTTGAGG + Intronic
1056877802 9:90351633-90351655 CTAGGTATTTTATTGTTTTTTGG - Intergenic
1056885471 9:90439234-90439256 CTAGAGTTTTTATAGTTTTGGGG + Intergenic
1058905654 9:109480642-109480664 CTAGGAGTTTTATGGCTTTAGGG + Intronic
1059077864 9:111213801-111213823 ATAGAATTTTTATGGTTTCAGGG + Intergenic
1059661277 9:116404197-116404219 CAAGGGTTCTTATGGATTGAAGG - Intergenic
1060013916 9:120069769-120069791 ATAGGGTTTTTATGCTTATATGG - Intergenic
1060037643 9:120270856-120270878 CTAGGGTTTTTGTGGTGTTAGGG + Intergenic
1060335132 9:122714830-122714852 CTAGGGTTTTTATTGTTTTGGGG - Intergenic
1060511671 9:124239310-124239332 CTCAAGTTTCTATGGTTTTAAGG + Intergenic
1061858735 9:133457036-133457058 CAAGGGCTTTTAGGGTTTTGTGG + Intronic
1203517594 Un_GL000213v1:17592-17614 CTAGGGTTTTTATAGTTTTTAGG + Intergenic
1186953185 X:14650843-14650865 CATGGGATTTTATTGTTTTAAGG + Intronic
1188824441 X:34813016-34813038 CTAGAAGTTTTATAGTTTTAAGG + Intergenic
1190140901 X:47843111-47843133 GTATGGTTTCTATGGTTTTAAGG + Intronic
1190391721 X:49938668-49938690 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1190515308 X:51217753-51217775 CCAGGGTTTTTATAGTTTTGGGG + Intergenic
1190575628 X:51834322-51834344 CTTGGGTTTTTATGGTGGTTAGG - Intronic
1190807159 X:53849267-53849289 CTAGGGTTTTTATGGTTTTATGG + Intergenic
1191031110 X:55973233-55973255 CTAGGGTTTATACAGCTTTAGGG - Intergenic
1191073280 X:56425170-56425192 CTAGGGGTTTTATGGTTTTAGGG + Intergenic
1191130050 X:56998269-56998291 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1191205083 X:57825061-57825083 CTAGAGTTTTTATGGTTTTAGGG + Intergenic
1191906937 X:66103406-66103428 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1191935771 X:66425844-66425866 CTAGGATTTTTGTAGTTTTGGGG - Intergenic
1191947165 X:66547406-66547428 CTAGGGATTTTATGGTTTTAGGG - Intergenic
1192021023 X:67391251-67391273 CCAGAGTTTTTATGCTTTTTAGG - Intergenic
1192253951 X:69439238-69439260 CTGGGCTTTTTATGGTTTGTAGG + Intergenic
1192392504 X:70745431-70745453 CTAGAGTTTTTTTTTTTTTAAGG - Intronic
1192921872 X:75715341-75715363 CTAGGGTTTTTATGGTTTTATGG + Intergenic
1192997630 X:76529179-76529201 CTAGGATTTTTATGGTCCTGGGG + Intergenic
1193060223 X:77197992-77198014 CTAGGATTTTTATAGTTTGAGGG + Intergenic
1193093037 X:77514637-77514659 CCAGGGTTTTTATAGTTTTCGGG - Intronic
1193159223 X:78208978-78209000 CTAAGGTTTTTATAGTTTGGAGG - Intergenic
1193184716 X:78498984-78499006 CTAGGGTTTTAATGCTCTTAGGG - Intergenic
1193314700 X:80050652-80050674 CTAGGGTATTAATGGTTTGGGGG + Intergenic
1193324881 X:80168526-80168548 CTAGAGTTTTAATAGTTTTTCGG - Intergenic
1193483093 X:82051788-82051810 CCAGGGTTTTTATAATTTGAGGG - Intergenic
1193577886 X:83226241-83226263 CAAGGGTTTTTATAGTTTCAGGG + Intergenic
1193590346 X:83381987-83382009 CTAAAGTTTTTATGATTTTATGG - Intergenic
1193628534 X:83850655-83850677 CTAGGGTTTTTATAGTTTTGGGG - Intergenic
1193704961 X:84810153-84810175 CTGGGGTTTTTGTGGTTTTAGGG + Intergenic
1193768104 X:85556518-85556540 CTAGGGTTTTTATGGTTTGGGGG + Intergenic
1193883543 X:86957027-86957049 TTCGGGTTTTTTTGGTTCTATGG + Intergenic
1193976137 X:88121286-88121308 CTAGGCTTTTTCTGGTTGTTAGG - Intergenic
1194019084 X:88665501-88665523 ATAGGGCTTTTATTGTTTTGAGG + Intergenic
1194780987 X:98025386-98025408 CTAGGGTTTTTATAGTTCTGGGG + Intergenic
1195040504 X:101009731-101009753 TTTGGGTTTTCTTGGTTTTAAGG - Exonic
1195126981 X:101817688-101817710 CTAAGATTTTTATGGTTTTTGGG + Intergenic
1195410036 X:104560202-104560224 TTAGGGTTTTTATGGTTTTTAGG + Intergenic
1195528826 X:105927620-105927642 ATATGGTTTTTATTGTTTTGAGG + Intronic
1195825861 X:108999861-108999883 CTAGGGTTTTTATGGCTTTTGGG + Intergenic
1196113056 X:111967851-111967873 CTAGGGTTGTTATGGTTTTAGGG - Intronic
1196149092 X:112352709-112352731 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1196933156 X:120701748-120701770 CCAGGGTTTTTATAGTTTTGGGG - Intergenic
1197142786 X:123134967-123134989 CCAGGATTTTTATAGTTTTGGGG - Intergenic
1197395012 X:125916702-125916724 CCAGGATTTTTATGGTTTGGGGG + Intergenic
1197453255 X:126644159-126644181 CTAGGATTTTTATAGTTTGAGGG - Intergenic
1197544112 X:127802702-127802724 CTAGGGTTTTTAGGGGTTTTAGG - Intergenic
1197584521 X:128328591-128328613 CTAGGGTTTTTATAGTTTGAGGG + Intergenic
1197672434 X:129292964-129292986 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1197678484 X:129356829-129356851 CTAGGGTTTTTACGGTTTTTAGG - Intergenic
1197841741 X:130755509-130755531 CTAAAATTTTTATGGTTCTATGG + Intronic
1197911628 X:131489041-131489063 CTAGAGGTTTTATAGTTTCAGGG - Intergenic
1198068514 X:133124313-133124335 CTAGGGTTTTTATAGTTTTTAGG + Intergenic
1198368137 X:135964038-135964060 CTAATGTTTTTAAGGTTTTTAGG - Exonic
1198660356 X:138961872-138961894 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1198663936 X:139001214-139001236 CTAGGGTTTTTATGGTTTTTAGG - Intronic
1198796743 X:140404918-140404940 CTAGAATTTTTATGGTTTCAGGG + Intergenic
1198858967 X:141049108-141049130 CTAGGGTTTTTATGGTTTTTTGG - Intergenic
1198903730 X:141538281-141538303 CTAGGGTTTTTATGGTTTTTTGG + Intergenic
1198959714 X:142171468-142171490 CTAGGGTTTTTATGGTTTTATGG - Intergenic
1199075359 X:143519315-143519337 CTAGGCTTTTATTGATTTTATGG - Intergenic
1199562183 X:149174714-149174736 CTAGAGTTTTGCTAGTTTTATGG - Intergenic
1199796662 X:151204864-151204886 CTAGGGTTTTTATGGTTTTTAGG - Intergenic
1200650840 Y:5838551-5838573 CTTGGGTTTTTATTGATTCATGG + Intergenic
1200878725 Y:8188877-8188899 CTAGGCTTTTTACGGTTTTTAGG + Intergenic
1201309103 Y:12578671-12578693 CTAGGGTTTTTATGGTTTTAGGG + Intergenic
1201352275 Y:13056965-13056987 CTAAGGTTTTTATAGTTTTGGGG + Intergenic
1201389739 Y:13484456-13484478 CTAGGGTGTTTATGGTTTTTAGG + Intergenic
1201582704 Y:15527362-15527384 GTAGGGTTTTTATGGCTTCTAGG + Intergenic
1201609113 Y:15821151-15821173 CTAGGGTTTTTATGTTTTTTAGG - Intergenic
1201751836 Y:17440807-17440829 CTAGGGTTTTTATGGTATTAGGG + Intergenic
1202043395 Y:20711567-20711589 CTAGGGTTTTTATGGTTTTAGGG - Intergenic
1202274205 Y:23098747-23098769 CTTGGGTTTTTATGCTTCTGGGG - Intergenic
1202291821 Y:23321930-23321952 CTTGGGTTTTTATGCTTCTGGGG + Intergenic
1202297006 Y:23369500-23369522 ATATAGTTTTTATAGTTTTATGG + Intergenic
1202427201 Y:24732492-24732514 CTTGGGTTTTTATGCTTCTGGGG - Intergenic
1202443590 Y:24937602-24937624 CTTGGGTTTTTATGCTTCTGGGG + Intergenic
1202573801 Y:26301097-26301119 ATATAGTTTTTATAGTTTTATGG - Intergenic