ID: 977978560

View in Genome Browser
Species Human (GRCh38)
Location 4:103296064-103296086
Sequence TCTAGGGTTTTTATGGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30371
Summary {0: 12773, 1: 6286, 2: 3517, 3: 3334, 4: 4461}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977978560_977978567 10 Left 977978560 4:103296064-103296086 CCTAAAACCATAAAAACCCTAGA 0: 12773
1: 6286
2: 3517
3: 3334
4: 4461
Right 977978567 4:103296097-103296119 GGCAATACCATTCAGGACATAGG 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
977978560_977978571 19 Left 977978560 4:103296064-103296086 CCTAAAACCATAAAAACCCTAGA 0: 12773
1: 6286
2: 3517
3: 3334
4: 4461
Right 977978571 4:103296106-103296128 ATTCAGGACATAGGCATGGTGGG No data
977978560_977978572 24 Left 977978560 4:103296064-103296086 CCTAAAACCATAAAAACCCTAGA 0: 12773
1: 6286
2: 3517
3: 3334
4: 4461
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978560_977978570 18 Left 977978560 4:103296064-103296086 CCTAAAACCATAAAAACCCTAGA 0: 12773
1: 6286
2: 3517
3: 3334
4: 4461
Right 977978570 4:103296105-103296127 CATTCAGGACATAGGCATGGTGG No data
977978560_977978565 3 Left 977978560 4:103296064-103296086 CCTAAAACCATAAAAACCCTAGA 0: 12773
1: 6286
2: 3517
3: 3334
4: 4461
Right 977978565 4:103296090-103296112 AAACCTAGGCAATACCATTCAGG 0: 8733
1: 11767
2: 5172
3: 2689
4: 1745
977978560_977978568 15 Left 977978560 4:103296064-103296086 CCTAAAACCATAAAAACCCTAGA 0: 12773
1: 6286
2: 3517
3: 3334
4: 4461
Right 977978568 4:103296102-103296124 TACCATTCAGGACATAGGCATGG 0: 13524
1: 7516
2: 2647
3: 1163
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977978560 Original CRISPR TCTAGGGTTTTTATGGTTTT AGG (reversed) Intergenic
Too many off-targets to display for this crispr