ID: 977978561

View in Genome Browser
Species Human (GRCh38)
Location 4:103296071-103296093
Sequence GTTTTCTTCTAGGGTTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25474
Summary {0: 13907, 1: 6005, 2: 2254, 3: 1484, 4: 1824}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977978561_977978567 3 Left 977978561 4:103296071-103296093 CCATAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 977978567 4:103296097-103296119 GGCAATACCATTCAGGACATAGG 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
977978561_977978568 8 Left 977978561 4:103296071-103296093 CCATAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 977978568 4:103296102-103296124 TACCATTCAGGACATAGGCATGG 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
977978561_977978571 12 Left 977978561 4:103296071-103296093 CCATAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 977978571 4:103296106-103296128 ATTCAGGACATAGGCATGGTGGG No data
977978561_977978570 11 Left 977978561 4:103296071-103296093 CCATAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 977978570 4:103296105-103296127 CATTCAGGACATAGGCATGGTGG No data
977978561_977978565 -4 Left 977978561 4:103296071-103296093 CCATAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 977978565 4:103296090-103296112 AAACCTAGGCAATACCATTCAGG 0: 8733
1: 11767
2: 5172
3: 2689
4: 1745
977978561_977978572 17 Left 977978561 4:103296071-103296093 CCATAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977978561 Original CRISPR GTTTTCTTCTAGGGTTTTTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr