ID: 977978563

View in Genome Browser
Species Human (GRCh38)
Location 4:103296080-103296102
Sequence ATTGCCTAGGTTTTCTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26067
Summary {0: 8236, 1: 10604, 2: 3986, 3: 1968, 4: 1273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977978563_977978571 3 Left 977978563 4:103296080-103296102 CCCTAGAAGAAAACCTAGGCAAT 0: 8236
1: 10604
2: 3986
3: 1968
4: 1273
Right 977978571 4:103296106-103296128 ATTCAGGACATAGGCATGGTGGG No data
977978563_977978568 -1 Left 977978563 4:103296080-103296102 CCCTAGAAGAAAACCTAGGCAAT 0: 8236
1: 10604
2: 3986
3: 1968
4: 1273
Right 977978568 4:103296102-103296124 TACCATTCAGGACATAGGCATGG 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
977978563_977978570 2 Left 977978563 4:103296080-103296102 CCCTAGAAGAAAACCTAGGCAAT 0: 8236
1: 10604
2: 3986
3: 1968
4: 1273
Right 977978570 4:103296105-103296127 CATTCAGGACATAGGCATGGTGG No data
977978563_977978567 -6 Left 977978563 4:103296080-103296102 CCCTAGAAGAAAACCTAGGCAAT 0: 8236
1: 10604
2: 3986
3: 1968
4: 1273
Right 977978567 4:103296097-103296119 GGCAATACCATTCAGGACATAGG 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
977978563_977978572 8 Left 977978563 4:103296080-103296102 CCCTAGAAGAAAACCTAGGCAAT 0: 8236
1: 10604
2: 3986
3: 1968
4: 1273
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977978563 Original CRISPR ATTGCCTAGGTTTTCTTCTA GGG (reversed) Intergenic
Too many off-targets to display for this crispr