ID: 977978564

View in Genome Browser
Species Human (GRCh38)
Location 4:103296081-103296103
Sequence TATTGCCTAGGTTTTCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29704
Summary {0: 8506, 1: 11179, 2: 4881, 3: 2884, 4: 2254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977978564_977978571 2 Left 977978564 4:103296081-103296103 CCTAGAAGAAAACCTAGGCAATA 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
Right 977978571 4:103296106-103296128 ATTCAGGACATAGGCATGGTGGG No data
977978564_977978570 1 Left 977978564 4:103296081-103296103 CCTAGAAGAAAACCTAGGCAATA 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
Right 977978570 4:103296105-103296127 CATTCAGGACATAGGCATGGTGG No data
977978564_977978568 -2 Left 977978564 4:103296081-103296103 CCTAGAAGAAAACCTAGGCAATA 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
Right 977978568 4:103296102-103296124 TACCATTCAGGACATAGGCATGG 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
977978564_977978567 -7 Left 977978564 4:103296081-103296103 CCTAGAAGAAAACCTAGGCAATA 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
Right 977978567 4:103296097-103296119 GGCAATACCATTCAGGACATAGG 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
977978564_977978572 7 Left 977978564 4:103296081-103296103 CCTAGAAGAAAACCTAGGCAATA 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977978564 Original CRISPR TATTGCCTAGGTTTTCTTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr