ID: 977978566

View in Genome Browser
Species Human (GRCh38)
Location 4:103296093-103296115
Sequence TGTCCTGAATGGTATTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27372
Summary {0: 8513, 1: 11095, 2: 4149, 3: 2051, 4: 1564}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977978566_977978572 -5 Left 977978566 4:103296093-103296115 CCTAGGCAATACCATTCAGGACA 0: 8513
1: 11095
2: 4149
3: 2051
4: 1564
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978566_977978573 25 Left 977978566 4:103296093-103296115 CCTAGGCAATACCATTCAGGACA 0: 8513
1: 11095
2: 4149
3: 2051
4: 1564
Right 977978573 4:103296141-103296163 GACTAAAACACCAAAAGCAATGG 0: 3395
1: 11928
2: 5227
3: 1057
4: 958
977978566_977978571 -10 Left 977978566 4:103296093-103296115 CCTAGGCAATACCATTCAGGACA 0: 8513
1: 11095
2: 4149
3: 2051
4: 1564
Right 977978571 4:103296106-103296128 ATTCAGGACATAGGCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977978566 Original CRISPR TGTCCTGAATGGTATTGCCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr