ID: 977978572

View in Genome Browser
Species Human (GRCh38)
Location 4:103296111-103296133
Sequence GGACATAGGCATGGTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977978560_977978572 24 Left 977978560 4:103296064-103296086 CCTAAAACCATAAAAACCCTAGA 0: 12773
1: 6286
2: 3517
3: 3334
4: 4461
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978566_977978572 -5 Left 977978566 4:103296093-103296115 CCTAGGCAATACCATTCAGGACA 0: 8513
1: 11095
2: 4149
3: 2051
4: 1564
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978563_977978572 8 Left 977978563 4:103296080-103296102 CCCTAGAAGAAAACCTAGGCAAT 0: 8236
1: 10604
2: 3986
3: 1968
4: 1273
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978564_977978572 7 Left 977978564 4:103296081-103296103 CCTAGAAGAAAACCTAGGCAATA 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978561_977978572 17 Left 977978561 4:103296071-103296093 CCATAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data
977978559_977978572 25 Left 977978559 4:103296063-103296085 CCCTAAAACCATAAAAACCCTAG 0: 44
1: 99
2: 75
3: 99
4: 397
Right 977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977978572 Original CRISPR GGACATAGGCATGGTGGGCA AGG Intergenic
No off target data available for this crispr