ID: 977980778

View in Genome Browser
Species Human (GRCh38)
Location 4:103318938-103318960
Sequence AGATATAAGCAAAAGTTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977980778_977980786 21 Left 977980778 4:103318938-103318960 CCCTACAACTTTTGCTTATATCT No data
Right 977980786 4:103318982-103319004 ATGATACCTATCTGCAAGGGAGG No data
977980778_977980784 17 Left 977980778 4:103318938-103318960 CCCTACAACTTTTGCTTATATCT No data
Right 977980784 4:103318978-103319000 CCACATGATACCTATCTGCAAGG No data
977980778_977980785 18 Left 977980778 4:103318938-103318960 CCCTACAACTTTTGCTTATATCT No data
Right 977980785 4:103318979-103319001 CACATGATACCTATCTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977980778 Original CRISPR AGATATAAGCAAAAGTTGTA GGG (reversed) Intergenic
No off target data available for this crispr