ID: 977987756

View in Genome Browser
Species Human (GRCh38)
Location 4:103404584-103404606
Sequence CTTCCCCCCGAGACGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977987754_977987756 10 Left 977987754 4:103404551-103404573 CCTGTTTTACAGCTTTAGAGTTT No data
Right 977987756 4:103404584-103404606 CTTCCCCCCGAGACGGAGTCTGG No data
977987753_977987756 19 Left 977987753 4:103404542-103404564 CCATAGATACCTGTTTTACAGCT No data
Right 977987756 4:103404584-103404606 CTTCCCCCCGAGACGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977987756 Original CRISPR CTTCCCCCCGAGACGGAGTC TGG Intergenic
No off target data available for this crispr