ID: 977992214

View in Genome Browser
Species Human (GRCh38)
Location 4:103457883-103457905
Sequence CCTGCTCTAAGTGGTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977992208_977992214 22 Left 977992208 4:103457838-103457860 CCTGAAAATGTTTCTACTATGTT No data
Right 977992214 4:103457883-103457905 CCTGCTCTAAGTGGTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977992214 Original CRISPR CCTGCTCTAAGTGGTTTTGG AGG Intergenic
No off target data available for this crispr