ID: 977992552

View in Genome Browser
Species Human (GRCh38)
Location 4:103461916-103461938
Sequence GATGACTTGCCATCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977992547_977992552 0 Left 977992547 4:103461893-103461915 CCCCCCTTTTTTTTTTTAATCAA No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992551_977992552 -4 Left 977992551 4:103461897-103461919 CCTTTTTTTTTTTAATCAAGATG No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992544_977992552 15 Left 977992544 4:103461878-103461900 CCTTAGTTCATTGCCCCCCCCTT No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992548_977992552 -1 Left 977992548 4:103461894-103461916 CCCCCTTTTTTTTTTTAATCAAG No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992550_977992552 -3 Left 977992550 4:103461896-103461918 CCCTTTTTTTTTTTAATCAAGAT No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992543_977992552 26 Left 977992543 4:103461867-103461889 CCTGCTTCTCTCCTTAGTTCATT No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992545_977992552 2 Left 977992545 4:103461891-103461913 CCCCCCCCTTTTTTTTTTTAATC No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992542_977992552 27 Left 977992542 4:103461866-103461888 CCCTGCTTCTCTCCTTAGTTCAT No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992549_977992552 -2 Left 977992549 4:103461895-103461917 CCCCTTTTTTTTTTTAATCAAGA No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data
977992546_977992552 1 Left 977992546 4:103461892-103461914 CCCCCCCTTTTTTTTTTTAATCA No data
Right 977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977992552 Original CRISPR GATGACTTGCCATCAAAGAA AGG Intergenic
No off target data available for this crispr