ID: 977992678

View in Genome Browser
Species Human (GRCh38)
Location 4:103463329-103463351
Sequence CTTAATTTATCCAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977992671_977992678 -7 Left 977992671 4:103463313-103463335 CCCACAGTTTTAAAATCTTAATT No data
Right 977992678 4:103463329-103463351 CTTAATTTATCCAGGGAAGGGGG No data
977992672_977992678 -8 Left 977992672 4:103463314-103463336 CCACAGTTTTAAAATCTTAATTT No data
Right 977992678 4:103463329-103463351 CTTAATTTATCCAGGGAAGGGGG No data
977992669_977992678 29 Left 977992669 4:103463277-103463299 CCATTTTTAGACAATGTCTAAAA No data
Right 977992678 4:103463329-103463351 CTTAATTTATCCAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977992678 Original CRISPR CTTAATTTATCCAGGGAAGG GGG Intergenic
No off target data available for this crispr