ID: 977993624

View in Genome Browser
Species Human (GRCh38)
Location 4:103476075-103476097
Sequence GGTCCCTGTACTTACCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977993624_977993630 6 Left 977993624 4:103476075-103476097 CCATCATGGTAAGTACAGGGACC No data
Right 977993630 4:103476104-103476126 ATGGGATTTTGCAGTGAGGGAGG No data
977993624_977993631 7 Left 977993624 4:103476075-103476097 CCATCATGGTAAGTACAGGGACC No data
Right 977993631 4:103476105-103476127 TGGGATTTTGCAGTGAGGGAGGG No data
977993624_977993633 15 Left 977993624 4:103476075-103476097 CCATCATGGTAAGTACAGGGACC No data
Right 977993633 4:103476113-103476135 TGCAGTGAGGGAGGGAGATTGGG No data
977993624_977993629 3 Left 977993624 4:103476075-103476097 CCATCATGGTAAGTACAGGGACC No data
Right 977993629 4:103476101-103476123 GAAATGGGATTTTGCAGTGAGGG No data
977993624_977993628 2 Left 977993624 4:103476075-103476097 CCATCATGGTAAGTACAGGGACC No data
Right 977993628 4:103476100-103476122 TGAAATGGGATTTTGCAGTGAGG No data
977993624_977993632 14 Left 977993624 4:103476075-103476097 CCATCATGGTAAGTACAGGGACC No data
Right 977993632 4:103476112-103476134 TTGCAGTGAGGGAGGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977993624 Original CRISPR GGTCCCTGTACTTACCATGA TGG (reversed) Intergenic
No off target data available for this crispr