ID: 977994180

View in Genome Browser
Species Human (GRCh38)
Location 4:103482719-103482741
Sequence TTTTGAATTCCTCTGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977994180_977994181 13 Left 977994180 4:103482719-103482741 CCAGACAACAGAGGAATTCAAAA No data
Right 977994181 4:103482755-103482777 GAGAGACTTCATCATTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977994180 Original CRISPR TTTTGAATTCCTCTGTTGTC TGG (reversed) Intergenic
No off target data available for this crispr