ID: 977996330

View in Genome Browser
Species Human (GRCh38)
Location 4:103500862-103500884
Sequence GTTCCATATGAAAAGGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977996326_977996330 -8 Left 977996326 4:103500847-103500869 CCCTCCATAAACTTAGTTCCATA No data
Right 977996330 4:103500862-103500884 GTTCCATATGAAAAGGTTATTGG No data
977996327_977996330 -9 Left 977996327 4:103500848-103500870 CCTCCATAAACTTAGTTCCATAT No data
Right 977996330 4:103500862-103500884 GTTCCATATGAAAAGGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977996330 Original CRISPR GTTCCATATGAAAAGGTTAT TGG Intergenic
No off target data available for this crispr