ID: 977997549

View in Genome Browser
Species Human (GRCh38)
Location 4:103513643-103513665
Sequence CTGGGATGCCAGTGAGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977997545_977997549 2 Left 977997545 4:103513618-103513640 CCAGTTGCTTGCTCTCTTTTCCT No data
Right 977997549 4:103513643-103513665 CTGGGATGCCAGTGAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977997549 Original CRISPR CTGGGATGCCAGTGAGTTGT AGG Intergenic
No off target data available for this crispr