ID: 978002352 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:103572079-103572101 |
Sequence | CTCTTCAGGGATGAGTCATG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
978002345_978002352 | 28 | Left | 978002345 | 4:103572028-103572050 | CCTTCGCAGTGAAACAAACATAT | No data | ||
Right | 978002352 | 4:103572079-103572101 | CTCTTCAGGGATGAGTCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
978002352 | Original CRISPR | CTCTTCAGGGATGAGTCATG TGG | Intergenic | ||