ID: 978002352

View in Genome Browser
Species Human (GRCh38)
Location 4:103572079-103572101
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978002345_978002352 28 Left 978002345 4:103572028-103572050 CCTTCGCAGTGAAACAAACATAT No data
Right 978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type