ID: 978006530

View in Genome Browser
Species Human (GRCh38)
Location 4:103623959-103623981
Sequence CAGTTAACCTAGATTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978006530 Original CRISPR CAGTTAACCTAGATTGAACA AGG (reversed) Intronic
904286691 1:29457439-29457461 CAGTGACCTTACATTGAACATGG - Intergenic
913097365 1:115531692-115531714 CAGTTAACATATAATGAGCAGGG - Intergenic
914372407 1:147039863-147039885 CAGTCAAACTAGAGTGGACAGGG - Intergenic
914577096 1:148982910-148982932 CAGTCAAACTAGAGTGGACAGGG + Intronic
916082756 1:161245571-161245593 CAGTGAGCCAAGATTGCACACGG - Intergenic
920334576 1:205236123-205236145 CAGTTAACCTGGCTGGAATAAGG - Intronic
1070550581 10:77487994-77488016 CAGTTAACCCATATTGCAGAAGG - Intronic
1071196910 10:83171997-83172019 AATTTAACTTAGATTGTACAAGG - Intergenic
1075146827 10:119889549-119889571 AAGTTAATATGGATTGAACAAGG + Intronic
1081306318 11:41516312-41516334 CAAATAACCTAGATTTAACATGG + Intergenic
1087476320 11:98639740-98639762 CTATTAACTTAGACTGAACACGG - Intergenic
1088173893 11:107028745-107028767 CAGCTTACTTATATTGAACAAGG + Intergenic
1095426233 12:42077339-42077361 CAGCTTACCTAGATTGATCTAGG + Intergenic
1096063119 12:48718655-48718677 CAGTTTACCTTGATTAAATATGG + Intergenic
1100838256 12:98587530-98587552 CAGAAAAGCTAGAGTGAACATGG - Intergenic
1103219949 12:119235628-119235650 CAGTTCAACTAGTTTGTACAAGG - Intergenic
1106844339 13:33721514-33721536 CAGATAACCTGTTTTGAACAAGG - Intergenic
1110063814 13:71075281-71075303 CAGTAAACCTAGAATATACAAGG + Intergenic
1115625991 14:35192512-35192534 CATTTATCCTAGAATGATCAGGG + Intronic
1120630117 14:86880380-86880402 CAGATATCCTAGATAGGACAGGG - Intergenic
1126075873 15:44908960-44908982 CAATTAACCCAGATTAAAAATGG + Intergenic
1134777108 16:16862943-16862965 AAGTTAACTGAGATTGAAAACGG + Intergenic
1135104737 16:19639014-19639036 CAGTGAACCGAGATTGCACCAGG + Intronic
1144512077 17:15886079-15886101 CAGTTAACCTACAGTGAAACTGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148009783 17:44468324-44468346 CAGGTAATCTAGACAGAACAAGG + Intronic
1150173778 17:63028141-63028163 CTGTAAACCAAGAATGAACAAGG + Intronic
1150940210 17:69684889-69684911 CAGTCTCCCAAGATTGAACAAGG - Intergenic
1156681958 18:39601103-39601125 CACATTACCCAGATTGAACAAGG - Intergenic
1156930446 18:42635935-42635957 CAGTTTTCCTAAATTGGACAGGG + Intergenic
1157062588 18:44309400-44309422 CAATTTCCCAAGATTGAACAAGG - Intergenic
1157459492 18:47875141-47875163 CAGTTAACATAAATTGCACATGG - Intronic
1159300451 18:66558770-66558792 TAGTTAACCTATATTTAACTAGG - Intronic
1160187921 18:76689670-76689692 CAGGAAATCTGGATTGAACATGG + Intergenic
1162929532 19:13950489-13950511 CATTTATCCCAGATTGAAGAAGG - Intronic
1164501627 19:28824901-28824923 CAGTTAGCCTAGATTTGACCGGG - Intergenic
1166869108 19:45860153-45860175 CAGTTAATATATATTGAACACGG + Intronic
1168396190 19:56050716-56050738 CAGTTTACCTAGATTGCCCTTGG - Intronic
930588701 2:53300725-53300747 CAGTTAACCTAAGATGGACAGGG + Intergenic
931759069 2:65400573-65400595 CAGTCGGCCTAGATGGAACATGG - Intronic
935549002 2:104431797-104431819 AAGTTAATGTAGCTTGAACAAGG + Intergenic
939078702 2:137633932-137633954 AAATTAACTTAGATTGAACATGG + Intronic
939865806 2:147471186-147471208 CAGTTAACAGAGATTGATCAGGG + Intergenic
944248724 2:197559747-197559769 CAGTTAACTTACCTTCAACAAGG - Intergenic
948142584 2:235684904-235684926 CAGTCATCCCAGATTGGACAGGG - Intronic
1170212479 20:13859289-13859311 CATATAAGCCAGATTGAACATGG + Intronic
1174977940 20:55355616-55355638 CAGTTAAGCTCCATTGAAAAGGG - Intergenic
1178006515 21:28226758-28226780 CAGTAAACCTGGATGGATCAGGG - Intergenic
1179088544 21:38242371-38242393 CTGTGAACCAAGATTGCACACGG + Intronic
1184814742 22:46861016-46861038 CAGTGAGCCAAGATTGACCAGGG - Intronic
951305488 3:21055675-21055697 CAGTTAACCTTGATACAATAAGG - Intergenic
951921564 3:27860244-27860266 CAGTTAACGTAGATTGAGTGTGG - Intergenic
952855902 3:37770714-37770736 CAGATCCCCTAGAGTGAACAGGG + Intronic
955806399 3:62740078-62740100 CTGTTGACCTAGACTGAGCATGG + Intronic
956911914 3:73827026-73827048 GAGTTAACCTAGTTAGAATAGGG + Intergenic
958069290 3:88588894-88588916 CAGTAAACCCAGATTGAACTGGG + Intergenic
958756610 3:98256998-98257020 CAATTTACCAAGATTGAACCAGG - Intergenic
960468931 3:118036126-118036148 CAGTTAATCTAGATTAAATTTGG - Intergenic
963130032 3:141849372-141849394 CAGTTAACCTTTCTTGATCAAGG + Intergenic
970786533 4:19803937-19803959 CTGTCAACCTGGATTGAAAAGGG - Intergenic
972880067 4:43411444-43411466 CAACTTACCAAGATTGAACAAGG + Intergenic
978006530 4:103623959-103623981 CAGTTAACCTAGATTGAACAAGG - Intronic
979234321 4:118382730-118382752 CAGTGAACCTAGATTGTGCCAGG + Intergenic
979508229 4:121522318-121522340 CAGGTAAACTAGTATGAACAGGG - Intergenic
985443447 4:190002564-190002586 CAGCTTACCCAGATTGAACTAGG - Intergenic
988008580 5:25452489-25452511 CAGTTATCCTAGAATGATAATGG + Intergenic
989329796 5:40243557-40243579 CTGTAAACATATATTGAACAAGG + Intergenic
990967071 5:61460491-61460513 CTGTTAACATACATAGAACATGG + Intronic
993611056 5:90055023-90055045 CAGTTTTCCTAGATTATACAGGG + Intergenic
995278275 5:110303537-110303559 CAGTCTACCAAAATTGAACAAGG - Intronic
995351399 5:111180025-111180047 CAGTGCACCTAGATTAAACCTGG - Intergenic
995793501 5:115918470-115918492 CAATTAGCCTAGATTGAAACAGG + Intergenic
997600503 5:135135314-135135336 CAGTTAACCCAGAGTGAATCAGG - Intronic
998114721 5:139527388-139527410 AAGTTAATTTAGACTGAACAAGG + Intronic
1001460398 5:171907506-171907528 TAGTAGACCTAGATTAAACATGG - Intronic
1004912275 6:20298343-20298365 CAGCTAACATATACTGAACAGGG - Intergenic
1005697248 6:28363227-28363249 TATTTAACTTAGATTGCACAGGG + Intronic
1006122989 6:31818639-31818661 TACTTAATCTAGATTCAACATGG + Intergenic
1011547257 6:88494727-88494749 CAGTTAAAGCAGATTGACCAAGG + Intergenic
1011690327 6:89861173-89861195 CAGTTGAGCTAGAATGAATAAGG + Intronic
1013240286 6:108238956-108238978 GAGTGAACCGAGATTGCACATGG - Intronic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1021559875 7:21958904-21958926 CAGTGAGCCGAGATTGAACCAGG + Intergenic
1030938113 7:115611727-115611749 CAGTGAGCCAAGATTGAACCCGG + Intergenic
1032226776 7:130038431-130038453 CAGGAAACCTAGGTAGAACATGG + Intronic
1034013175 7:147553170-147553192 GAGTTCCCCTAGATTGGACAGGG + Intronic
1038137923 8:24810130-24810152 CATTTAAGCTAGATTCACCAAGG + Intergenic
1038784756 8:30601972-30601994 CAGTTACCCTAGAATGTAAATGG - Intronic
1038853413 8:31303444-31303466 CAGTGAGCCAAGATTGAACCAGG - Intergenic
1039235228 8:35495683-35495705 CAGTTTACCTGGGTTCAACAAGG + Intronic
1042427430 8:68664333-68664355 CAGTTAACCTAAATGGCATAAGG + Intronic
1045448383 8:102291689-102291711 CAGTTAACCAACACTGAACCAGG - Intronic
1052427010 9:28318086-28318108 CAGTGAACCTTGAAAGAACATGG - Intronic
1059920650 9:119156732-119156754 CTCTTAACCTAGATTGGACCGGG - Intronic
1061228011 9:129292019-129292041 CAGTTAACTTAGAGTTAACATGG + Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1194264362 X:91736927-91736949 CAACTAACCTAGACTGAACCAGG - Intergenic
1194919023 X:99741474-99741496 CAGTTTACCTATGGTGAACAAGG - Intergenic
1197290271 X:124647882-124647904 CAGGTAATTTAGATTGAAAAGGG - Intronic
1200722311 Y:6621545-6621567 CATTTAGAATAGATTGAACATGG + Intergenic